2. Compare the key players in DNA replication, PCR, transcription, and translation by filling out a table such as this one (this is just a template, you will need more space than what's provided here). Provide a brief description of the function of each of the key players in your table. Key players Replication PCR Transcription Translation DNA components RNA components Protein components

2. Compare the key players in DNA replication, PCR, transcription, and translation by filling out a table such as this one (this is just a template, you will need more space than what's provided here). Provide a brief description of the function of each of the key players in your table. Key players Replication PCR Transcription Translation DNA components RNA components Protein components

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 4TYK: After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify...

See similar textbooks

Similar questions

3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase Reverse transcriptase RNA Polymerase Endonuclease 6. Sanger DNA sequencing relies on a method known as chain termination. Which molecule is used to terminate DNA chains to create molecules of all possible lengths covering the fragment to be sequenced? Deoxyribonucleotides Deoxyadenosine Deoxyguanosine Dideoxynucleotides
Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively demonstrated that DNA (a) is a double helix (b) replicates semiconservatively (c) consists of repeating nucleotide subunits (d) has complementary base pairing (e) is always synthesized in the 5 3 direction
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
After a polymerase chain reaction (PCR), agarose gel electrophoresis is often used to: a. amplify the DNA. b. convert cDNA into genomic DNA. c. convert cDNA into messenger RNA. d. verify that the desired DNA sequence has been amplified. e. synthesize primer DNA molecules.
1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is for DNA polymerase.60-word limit
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
1. For each of the processes below, fill in blanks with one or more of the items in the following list: Ligase (L), Primase (P), enzyme with 5' to 3' activity (E), RNA-dependent polymerase (RNA-DP = polymerase which uses RNA template), DNA-dependent polymerase (DNA-DP=polymerase which uses DNA template). for PCR you need............. for normal mRNA synthesis you need........ for normal DNA synthesis you need........ for normal tRNA synthesis you need....... 2. (please explain) Suppose the DNA synthesis that occurs in PCR is less accurate than cellular DNA synthesis (as in, PCR has a higher error rate than normal DNA synthesis). This difference in error would most likely be because the polymerase used in PCR: a) has a low level of 5' to 3' exonuclease activity b)has a low level of 3' to 5' exonuclease activity c) has a low temp at which it denatures d) adds to the 5' end of the growing DNA chain e) does not use template
1. Below is an amino acid sequence for the following strand of DNA:A G C A A T C C G T C T T G GT C G T T A G G C A G A A C CThat strand has mutated. It is nowA G C A A C C C G T C T T G GT C G T T G G G C A G A A C CUse your knowledge of mutation and protein synthesis to answer the following questions.What mutation has occurred? A. point mutation B. movement of large section of chromosome C. duplication of entire chromosome D. genetic recombination 2. Will this mutation have a real effect? Why or why not?
Give 2 differences between a DNA library and a cDNA library