following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA sequence being read shifts rover by a base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? GCUACAUCUUUA c. If a gene mutation results in a point mutation, meaning a single nucleotide is converted to a different nucleotide base, and the translation machinery codes, instead, using the nucleotide sequence below what is the anmino acid seguence in the resulting portion of

following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA sequence being read shifts rover by a base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? GCUACAUCUUUA c. If a gene mutation results in a point mutation, meaning a single nucleotide is converted to a different nucleotide base, and the translation machinery codes, instead, using the nucleotide sequence below what is the anmino acid seguence in the resulting portion of

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a transition leading to a silent mutation in the second amino acid. Bold or underline the nucleotide that has been changed
a) Identify the current stage of the translation process shown in Figure 1 and name the anticodon sequence in tRNAb) State TWO immediate, main consequences when a stop codon reaches the E site.
a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?
Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA template strand. (Remember that mRNA has uracil instead of thymine.) Template Strand: CGATACAAA
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5′—UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU—3′
Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGC
Which of the following are stages of translation? Select all that apply. A. A tRNA binds to the second codon and its carried amino acid forms a peptide bond with methionine. B. As the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide. C. When the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released. D. Ribosomal subunits and a tRNA carrying methionine converge on the start codon of an mRNA. E. The binding of a tRNA to the third codon causes the ribosome to release the first tRNA and move to the next codon.