Q: What molecule is involved in organism to organism communication? O Hormones O Sebaceous sweat glands...
A: Pheromones are chemical messengers and chemical signals produce by animals.
Q: Imagine that two unlinked autosomal genes with simple dominance code in goats for size, where L is l...
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous c...
Q: organisms that use light energy as carbon source is known as Select one: a. chemoHeterotrophs b. pho...
A: Introduction: Nutrition is the process of taking food by an organism as well as the utilization of ...
Q: What eye phenotype is expected in a fruit fly with this genotype: w-,ey>Flp/ Y; FRT42D/ FRT42D, Ark8...
A: Question 7: The correct answer to this question is: 1. Curly Wings 2. No, mitotic recombiniation did...
Q: Why living things over time have changed?
A: Introduction: Evolution is a change in the characteristics of living things over time.In natural sel...
Q: What conditions and food can lead to B. cereus food poisoning outbreak
A: INTRODUCTION Bacillus cereus has become an important cause of food poisoning. It is widley distribut...
Q: Identify the monomers for the following polymers A.) Maltose B.) Sucrose C.) Lactose
A: INTRODUCTION The monomer of the polymers is given below.
Q: an you please help answer this question?
A: the speed of the deer is increased to satisfy their hunger. Some salamander species emerge from thei...
Q: what becterial cell structure serves as the site of antibacterial action? a. cell membrane b. nucle...
A: Note: As Per Bartleby Guidelines only first question is answered.For Further Answers Please Repost T...
Q: Communities of organisms, together with abiotic entities, make up an ecosystem. What are these "abio...
A: Given: Communitiies of organisms together with abiotic entities make up an ecosystem.Ecology is the...
Q: 4. What would be the phenotypes, phenotypic ratio, and gen kids, if the mother is heterozygous freck...
A: An Individuals receive two variant of each gene from their parent. These variant form of a gene are...
Q: What are gratuitous inducers ? Explain importance of gratuitous inducers ?
A: An inducer is a molecule that regulates gene expression in molecular biology. An inducer can be used...
Q: Why is the orientation of the bases on the inside of the DNA molecule important to the structure and...
A: DNA is an organic molecule that includes genetic information as well as instructions for protein cre...
Q: Which lobe of the cerebral cortex is the center for impulse control (the brain's "stop sign")? parie...
A: As the nervous system is one of the most important system present in the body;which are able to main...
Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is th...
A: Untranslated regions are present in RNA which are transcribed but not translated on either end of th...
Q: Mainland population allele frequencies before migration Island population allele frequencies before ...
A: allele frequencies change in the direction of the donor/source population due to migration. So for c...
Q: In the self of a polygenic trihybrid R1/r1 ; R2/r2 ; R3/r3,use the product and sum rules to calculat...
A: When a self cross takes place between the polygenic hybrid, then: The probability in which only one...
Q: What membrane process releases neurotransmitters into the synapse during an action potential O Activ...
A: During an action potential, the vesicles containing neurotransmitters migrate toward the presynaptic...
Q: Question 29 Sponges A Cnidarians Ancestral colonial protist Flatworms Molluscs В Annelids Nematodes ...
A: Theory and practice of classifying organisms is termed as taxonomic. The word taxis means arrangemen...
Q: What is cisacting site ?
A: cis means " same side". The cis acting site acts as a site of DNA or RNA which helps in regulating t...
Q: What type of trait and genetic interactions are shown below? Environment Gene 1 Phenotype Gene 2 Gen...
A: Option c
Q: What part of the nerve cell sends signals away from the cell body O None of these is correct O Dendr...
A: Introduction :- A neuron, also known as a nerve cell, is a type of electrically excitable cell that ...
Q: 2. Label the cell division photos. 1. Identify the stage of mitosis. 3. Identify the stage of mitosi...
A: A cell must do many crucial activities in order to divide: it must develop, duplicate its genetic ma...
Q: The plant Haplopappus gracilis has a 2n of 4. A diploid cellculture was established and, at premitot...
A: Introduction A normal cell can divide by two processes one is Mitotic cell division while the secon...
Q: 2. In tomatoes, 2 pairs of genes affect the phenotypes of ripe fruit with the following alleles. R= ...
A: Answer - A) Rroo x rrOo Rr rr oo Rroo rroo Oo RrOo rrOo The phenotypic ratio of the giv...
Q: Which of the following best describe(s) the process of X-inactivation? Group of answer choices It o...
A: Human contains 23 pairs of chromosomes out of which 22 pairs are autosomes and one pair of sex chrom...
Q: Explain three functionally distinct compartments in drug absorption 1.intracellular compartment 2.pl...
A: Fir drug absorption passive diffusion is the mechanism. For drug absorption in humans and related o...
Q: The figure here shows oxygen concentration in a suspension of isolated mitochondria. Immediately aft...
A: Cellular respiration involves breakdown of glucose and production of energy in the form of ATP. Diff...
Q: Assume that diploid plant A has a cytoplasm genetically different from that of plant B. To study nuc...
A: Pollination is the process of transporting pollen from the anther (male part of a flower) to the sti...
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...
Q: Which of these is a correct statement about energy-yielding pathways in bacteria? O Anaerobic respir...
A: All pathogens are heterotrophic bacteria that acquire energy from the oxidation of organic molecules...
Q: . A dark female moth is crossed with a dark male. All themale progeny are dark, but half the female ...
A: The allele A is dominant over a. So, the moth with 'AA' and 'Aa' will be dark-colored. Moth with 'aa...
Q: Select the disease which makes lungs lose its elasticity due to the inflammation of alveoli. A. Lung...
A:
Q: Why are men more prone to hemophilia than women? Elaborate.
A: Hemophilia is a disorder related to blood that causes blood to clot improperly. A deficiency of coag...
Q: TAG, TA, and TGA are stop codor
A: 4) The 5' cap is added to the first nucleotide in the transcript during transcription. The cap is a ...
Q: An area(s) of the brain long recognized as crucial to overall arousal and attention is the: left hem...
A: Thalamus plays crucial role in attention and arousal (consciousness level)
Q: Referring back to the quaternary level proteins, list and describe the modifications that can be mad...
A: The structure of protein includes sequence of amino acids in a polypeptide chain. The formation of t...
Q: A species of cleaner fish removes parasites from another species of fish that is much bigger in size...
A: In Ecology there are different types of interactions defined between the individuals which remain in...
Q: What is the predominant ionic form of ribose-5-phosphate at physiological pH?
A: The predominant ionic form of ribose-5-phosphate at physiological pH is 5-Phosphoribosyl-1-Pyrophosp...
Q: Where is the portal of exit of Legionellosis (Legionnaires disease) and what are its hosts?
A: The pathway via which a pathogen departs its host is known as the portal of exit. The pathogen's loc...
Q: Examples of bacterial genera that cannot be cultured using artificial media
A: Bacteria usually has very low nutritional requirement and hence can be easily cultured in artificial...
Q: Explain the ramifications of medical waste being dumped into the ocean in greater detail.
A: Introduction :- Any waste containing infectious (or possibly contagious) items is classified as biom...
Q: What happens when you eat? How does a breakfast of scrambled eggs with spinach and multi-grain toast...
A: Introduction: Nutrients are components in food that an organism uses to survive and grow. They are ...
Q: Study guide 15
A: In sublingual administration the tablet is allowed to dissolve completely in the oral cavity. It tak...
Q: DNA plus associated proteins equal? a. chromatin b. chromosome c. chromatid d. nucleosome
A: Introduction :- Proteins are big, complex molecules that play a number of important tasks in the hum...
Q: Name 3 organs in the human body?
A: As per levels of structural organization of the body , cell is elemental unit of the body and consis...
Q: In the Latin name Canis lupis , the "Canis" is the name of the corresponding: a. Species c. Genus 1....
A: “Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: How living things over time have changed? Why some of them have become extinct?
A: Introduction :- Extinction is the death of a type of organism or a group of organisms (taxon), most ...
Q: What things should a parent/doctor/child consider when deciding if someone should go on puberty dela...
A: Pubertal blockers are medications or hormone supplements that stop or block the signal from the brai...
Q: Why is the cardiac action potential propagated more slowly in an AV node cell then in an atrial or v...
A: Cardiac action potential It refers to the short alteration in the voltage i.e. membrane potential a...
Step by step
Solved in 2 steps with 1 images
- Only do the following- synthesize a monoglyceride and diglycerides and attach them below. Make sure to identify which is which!true or false; 1. aarachidnonic acid is the amjor starting material for eicosanoids 2.both gylycoholic and taurocholic acid contain a side chain amide linkage 3. both cholesterol and cholic acid contain methyl group attachementPLEASE HELP 1. How many chirality centers does ribose have? Identify them.
- ɡive me example about the arranɡements of heptapeptide such as Arɡ, Phe, Val and etc.Quantitative Estimation of Amino Acids by Ninhydrin http://vlab.amrita.edu/?sub=3&brch=63&sim=156&cnt=2 can u help me with question 2 of the assignment questions Based on the experimental data provided, estimate the amount of amino acid in the given unknown solution by Ninhydrin method. SI No. Volume of standard amino acid solution (ml) Amount of amino acid (µg) OD at 570nm 1 Blank 0 2 0.2 0.12 3 0.4 0.25 4 0.6 0.45 5 0.8 0.55 6 1.0 100 0.68 7 Unknown (0.5ml) 0.411. Structure, localization and biological significance of glycogen.