Arial5 of 10 761 wordsAav PoBIUab x₂ x² A.A.2. Identify the following structures when given images such as the ones below:● process of transcriptionprocess of translation●ligands• receptor proteins (in either the cell membrane or in the cytoplasm or nucleus)● nucleus●● nuclear membranenuclear pores● ribosomes●●DNAmRNA● tRNA• growing polypeptide chainEX English (United States)AaBbCcDd EeNormalmana| AaBbCcDdlNo SpacingMacBook Air| AaBbLCUCHeading 1Heading 2Focus E FTitleEStylesPaneI 61 wordsse Rubl LetallAAN.IX English (United States)MacBook Air

The cellular process is metabolic activities that occur inside the cell, contributing to sustaining…

Answered: 2. Identify the following structures…

Science

Biology

2. Identify the following structures when given images such as the ones below:

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 12TYK: Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is...

See similar textbooks

Related questions

Q: What is the coordinate for TSS_tra_16584216?

A: Explanation: The TSS_tra_16584216 is a coordinate that marks the location of the transcription…

Q: Which of the following factors stabilizes population growth into an S-shaped curve? a. limited…

A: Increases in a population's or a dispersed group's membership are referred to as population growth.…

Q: Is omicron deadly

A: Introduction The novel coronavirus SARS-CoV-2, which first appeared in Wuhan, China in 2019, and…

Q: Determine the advice that a genetic counsellor can give to the parents about MERFF that might…

A: The illness known as myoclonus epilepsy with ragged red fibres, or MERFF, is brought on by a…

Q: When red blood cells are placed in distilled water they burst open,why this was happens?

A: A solution with a lower solute concentration than another solution is called hypotonic, and a…

Q: Determine the method of distinguishing whether the bacteria has penicillinase activity or if the…

A: Penicillin works by preventing the manufacture of peptidoglycan, which is a crucial part of both…

Q: estion 1. a) Draw and discuss e components, location, energy anges, what reducing equivalents e…

A: in glycolysis a molecule of glucose is degraded in a series of enzyme catalyzed reactions to yield 2…

Q: What is photosynthesis?

A: Plants work as factories for carbohydrate production. Carbon Dioxide is generated by the cells of…

Q: Is alcoholism differ from other diseases, such as, heart disease, cancer, diabetes and HIV? If…

A: Alcoholism, roughly speaking, is any alcohol consumption that causes serious issues with mental or…

Q: Give the importance of heating laboratory technique (e.g heating in a beaker)

A: Muffle furnaces, hot air ovens, bunsen burners, hot plates, heating mantles, hot oil baths, and…

Q: Will Covid be a concern this winter in Ontario Canada

A: Covid is caused by coona virus. It is an infectious disease.

Q: Based on this information, answer the following questions. a) What is the possible microbial…

A: Inflammation of the cerebrospinal fluid (CSF) and meninges surrounding the brain and spinal cord is…

Q: GAT C |||||||| ||||| | || | | || | || | || a.) What is the base sequence of the sample ssDNA? b.) If…

A: NUCLEOTIDE SEQUENCING: The process of determining the order of nucleotides in a genome is known as…

Q: 3 ways in which carbon dioxide is transported by the renal vein

A: Cell metabolism in the mitochondria results in the production of carbon dioxide. The output is…

Q: with a doubling time of 45-minutes? Use the foll

A: Given Birth size of E coli is 1 micron=10-6 water content of cell =80% Percentage of dry mass of…

Q: ▶ Question 10 1 12 3 07 O 11 2n 11 10 6 8 and/or 8 7 In the figure above, which number represents…

A: Introduction: Gymnosperm flowers produce the pollen through the microsporangia of a male cone,…

Q: At which point in the trophic pyramid is the greatest arount (not percentage) of energy lost? A)…

A: The trophic pyramid can be described as a structural distribution of biological communities, which…

Q: Describe the importance of fungi in biology and medicine and the way in which fungi infect humans…

A: Introduction Fungus is the eukaryotic organisms that belong to the Kingdom of Fungi. These organisms…

Q: Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual Phenotype…

A: Introduction:- Chromosome usually represent the long chain DNA molecules that have the genetic…

Q: The sequence of the template strand if a nontemplate strand has the sequence 5 ATGGGGCGC3

A: The coding strand determines the correct nucleotide sequence of mRNA. The template strand acts as a…

Q: What is a plant cell

A: Introduction Cell: they are the box or chamber-like structure containing fluid-like cytoplasm…

Q: Give 3 ways of how water pollution can be controlled

A: Water pollution is a big problem that needs to be controlled. Many people do not realize how much…

Q: what is the lung cancer sample collection

A: Introduction Cancer is a lifestyle disease which can be caused by abnormal or unhealthy lifestyle…

Q: mple, if you feel that the statement demonstrates context, but not the calculation or the parison,…

A: The question is asking that which parameter can be associated with this question. A graph has been…

Q: Which statement is true about transposon? a. Transposon is known as a ‘jumping gene’. b.…

A: The science of genes and inheritance, or how particular characteristics or traits are transferred…

Q: 2 3 4

A: When when a growth of particular Organism or population is recorded and represented in graphical…

Q: When do you think medical care becomes a public health responsibility, and what problems are…

A: The science of safeguarding and enhancing the health of individuals and their communities is known…

Q: 8. The table below shows what happens when we inhale. Gas Inhaled 20.71% 0.04% 1.25% Exhaled 14.6%…

A: Introduction The process of respiration (inhalation of oxygen and exhalation of carbon dioxide) is…

Q: ermine the use of metagenomics to discover new pathogens and create antibiotics to eliminate them.

A: Antimicrobials are chemicals or substances that either stop bacteria from growing or actually kill…

Q: Determine the advantages of phage therapy over antibiotict herapy.

A: Bacteriophage therapy (BT) is another name for phage therapy (PT). It treats bacterial infections…

Q: 1. You are a research assistant in a renowned science academy. Your supervisor requires you to…

A: PCR:- it is used to amplify the fragments of a DNA or gene of interest. Gene cloning:- it is a…

Q: Make a claim regarding the decreasing deforestation of the Brazilian rainforest from 2001-2013. Cite…

A: Deforestation is the purposeful clearing of forested land. Throughout history and into modern times,…

Q: Skin colour in dolphins is determined by a single gene showingincomplete dominance giving rise to 3…

A: Genes can be classified as dominant or recessive. Genes with dominant functions control what traits…

Q: Helicases are motor proteins that translocate on nucleic acids: Describe the structure of the…

A: Helicases are enzymes present in the body. Helicase is necessary for the movement of pumps present…

Q: Why inoculate from just a single colony?

A: A microbiological culture, also known as a microbial culture, is a technique for growing organisms…

Q: Q1. Determine if the event occurs during mitosis or during meiosis. Copy and paste, mitosis or…

A: The cell division is the process of making two or more daughter cells from a parent cell. There are…

Q: ? Question Type your response in the box. Examine the image. Explain how the spider's genes and…

A: Q. Examine the image. Explain how the spider's genes and environment have influenced its…

Q: can u pls explain the photo? (direction: cut and paste or illustrate images of the given ecological…

A: Ecological communities are made up of all the species living together in an area. In community…

Q: 4. The diagram below shows the process of protein synthesis. Label the numbered parts of the…

A: This picture represent the translation process which is the formation of polypeptide chain from…

Q: Determine the 17 b p primers that can be used to locate the gene into which the transposon is…

A: The genes are a series of nucleotides found on chromosomes that code for a particular protein that…

Q: Determine the advantage of regulating the binding of RNA polymerase to DNA at the promoter.

A: The synthesis of RNAs and proteins in accordance with the instructions contained in deoxyribonucleic…

Q: Various options are provided as possible answers to the following questions. Choose the correct…

A: Introduction: The quantity of genetic traits (alleles and genotypes) present in a species is…

Q: Analysis the features of a maize plant and classify it into the appropriate plant group

A: Plants are classified into different groups based on their features. The two main groups of plants…

Q: 99: All of the following are associated with Homo erectus, EXCEPT Group of answer choices A:…

A: The genus or group name for this species is homo, which is a Latin word that means "human" or "man."…

Q: What does smooth muscle cell do to our body

A: Introduction Animals have four types of tissues found in their body. Epithelial tissue Connective…

Q: 8. Determine the mechanisms that DO NOT contribute to the genetic variations among the offspring. A.…

A: Introduction Cell division is that the technique through that a parent cell divides into a pair of…

Q: Explain the principle behind chemical transf

A: Introduction A chemical transformation defines as the process by which molecules collide with…

Q: Procedure A. Applying the terms of science The following fictional experiment demonstrates the use…

A: Science is a means of knowing that is always evolving and altering. Scientists are constantly…

Q: A strain of Escherichia coli has been genetically modified to produce human protein. A batch culture…

A: Given that, Initial conc. of substrate, i.e., glucose (S0)= 10 g/l Let's assume that, the substrate…

Q: Illness and infections typically cause:

A: Illness is any unhealthy condition which alters the normal body health. It could be acute or chronic…

Question

Arial
5 of 10 761 words
Aav Po
BIUab x₂ x² A.A.
2. Identify the following structures when given images such as the ones below:
● process of transcription
process of translation
●
ligands
• receptor proteins (in either the cell membrane or in the cytoplasm or nucleus)
● nucleus
●
● nuclear membrane
nuclear pores
● ribosomes
●
●
DNA
mRNA
● tRNA
• growing polypeptide chain
EX English (United States)
AaBbCcDd Ee
Normal
mana
| AaBbCcDdl
No Spacing
MacBook Air
| AaBbLCUC
Heading 1
Heading 2
Focus E F
Title
E
Styles
Pane
I

61 words
se Rubl LetallAAN.
IX English (United States)
MacBook Air

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Explanation

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Contrast transcription and translation. Name at least three differences between the two processes.
Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is transcribed, the result is the following mRNA molecule: In a mutated form of the gene, two extra base pairs (underlined) are inserted: What effect will this particular mutation have on the structure of the protein encoded in the gene?
Discuss Concepts A mutation occurs that alters an anticodon in a tRNA from 3-AAU-5 to 3-AUU-5. What effect will this mutation have on protein synthesis?
Which of the following phases is characterized by preparation for DNA synthesis? G0 G1 G2 S
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
22-69 Indicate whether each of the following statementsrelating to protein synthesis is true or false.a. RNA is involved in both the transcription andtranslation phases of protein synthesis.b. DNA is the starting material for protein synthesis.c. The translation phase of protein synthesis convertsRNA to DNA.d. Transcription precedes translation in proteinsynthesis
1. This complex assembles and organizes nucleosomes and contributes to gene repression Group of answer choices a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 2. A DNA lesion occurring when the deoxyribose molecule loses an adenine or a guanine base. Group of answer choices a. Depurination b. Deamination c. Depyrimination d. Denaturation 3. The difference between a nucleoside and nucleotide is: Group of answer choices a. Nucleotides contains deoxyribose sugar and nucleosides contain ribose sugar b. A nucleoside consists of the sugar with a nitrogenous base, whereas a nucleotide has sugar with a nitrogenous base and phosphate groups attached to the sugar. c. A nucleotide consists of the sugar with a nitrogenous base, whereas a nucleoside has sugar with a nitrogenous base and phosphate groups attached to the sugar. d. Nucleotides are involved in eukaryotic DNA replication, while nucleosides are used in bacterial DNA replication