Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual Phenotype Sequence A IV-3 B IV-4 B IV-8 BIV 9 CIV-3 DIV-4 Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA 2. Identify and highlight all the nucleotides that differ between at least two sequences in each table. 3. Pretend that you are the researcher who discovered the variations and you are writing to a colleague describing what you found. a. How would you describe the variation(s) you found in Sequence 1? b. How would you describe the variation(s) you found in Sequence 2?

Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual Phenotype Sequence A IV-3 B IV-4 B IV-8 BIV 9 CIV-3 DIV-4 Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA 2. Identify and highlight all the nucleotides that differ between at least two sequences in each table. 3. Pretend that you are the researcher who discovered the variations and you are writing to a colleague describing what you found. a. How would you describe the variation(s) you found in Sequence 1? b. How would you describe the variation(s) you found in Sequence 2?

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 2DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

Linkage analysis. is used to create a physical map is based on the natural recombination process requires radiation hybrid mapping involves breaking and rejoining of DNA artificially
A plasmid is a circle of ___ . a. RNA b. DNA c. either RNA or DNA d. histone proteins
EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA Protein
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Below is a diagram of the general structure of the bacteriophagel chromosome. Speculate on the mechanism by which it forms aclosed ring upon infection of the host cell. 5'GGGCGGCGACCT:double@stranded region-3' 3'- double@stranded region:CCCGCCGCTGGA5'
Escherichia coli O157:H7 can cause serious food-borne illness. This strain of E. coli has acquired the ability to create a toxin normally produced in the bacterial species Shigella. Which of the following would not explain this ability found in E. coli?a) reproductionb) recombinationc) conjugationd) transductione) transformation
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Ultraviolet light causes thymine dimers to form in DNA. Some individuals are genetically incapable of repairing these dimers at "normal" rates. Such individuals are likely to suffer from _________________ due to a defect in their ___________________ DNA repair pathway. Severe Combined Immunodeficiency (SCID); DNA proofreading pancreatic cancer; base excision colon cancer; non-homologous end-joining muscular dystrophy; base-excision xeroderma pigmentosum; nucleotide excision
Define the following terms: Bacteriophage λ DNA Plasmid Map
Single nucleotide polymorphisms are found ina. DNA. b. RNA.c. plasmidsd. siRNA
E. coli cells are simultaneously infected with two strains of phage λ. One strain has a mutant host range, is temperature sensitive, and produces clear plaques (genotype h st c); another strain carries the wildtype alleles (genotype h+ st+ c+). Progeny phages are collected from the lysed cells and are plated on bacteria. The following numbers of different progeny phages are obtained: Progeny phage genotype Number of plaques h+ c+ st+ 321 h c st 338 h+ c st 26 h c+ st+ 30 h+ c st+ 106 h c+ st 110 h+ c+ st 5 h c st+ 6 a. Determine the order of the three genes on the phage chromosome. b. Determine the map distances between the genes. c. Determine the coefficient of coincidence and the interference
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: