2. The polypeptide chain that makes up a tight junction weaves back and forth through the membrane four times, with two extracellular loops, and one loop plus short C-terminal and N-terminal tails in the cytoplasm. What would you predict about the amino acid sequence of the tight junction protein?

2. The polypeptide chain that makes up a tight junction weaves back and forth through the membrane four times, with two extracellular loops, and one loop plus short C-terminal and N-terminal tails in the cytoplasm. What would you predict about the amino acid sequence of the tight junction protein?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter4: Cells

Section: Chapter Questions

Problem 5TYK: Which of the following are glycoproteins whose function is affected by the common cold birus? a....

See similar textbooks

Related questions

Q: Which of the following statements about membrane phospholipids is/are true? a) They are…

A: All living things are made up of cells, which are the most basic and important unit. All of life's…

Q: 8. All of the following are typical components of the plasma membrane of a eukaryotic cell Except.…

A: Introduction :- The plasma membrane, also known as the cell membrane, is the membrane that separates…

Q: 4) Membrane Structure Can you draw, label, and/or explain key components of a phospholipid bilayer?…

A: The lipid bilayer (also known as the phospholipid bilayer) is a polar membrane consisting of two…

Q: 3. The primary amino acid sequence of a stretch of polypeptide is Asp-Glu-Pro- Lys-His-Arg. Would…

A: Alpha helix is one of the most common secondary structures of proteins which is formed by the…

Q: 4. The cell membrane is said to be amphipathic. What does it mean and what is its significance?

A: The word amphipathic is defined as a chemical compound containing both polar (water-dissolvable) and…

Q: 6. Why would a cell want to aggregate ions on one side of a cell membrane?

A: Cell membranes, additionally called plasma membranes, are found altogether cells and serve to…

Q: 8. Increasing the number of these molecules in the cell membrane would increase the permeability of…

A: Biomolecules are number of molecules which is produced or secreted from living organism. Major types…

Q: 10. The final conformational shape of proteins and interactions with their environment and other…

A: Protein folding depends upon its outer environment. Polar amino acids present towards outside when…

Q: 1. Please come up a peptide sequence for the two proteins shown in the diagram. Multi-pass protein…

A: The proteins shown in the diagram are single-pass protein and multi-pass protein, they are generally…

Q: 1. Which amino acids would most likely be found in the transmembrane spanning region of an integral…

A: Amino acids are the constituents or sub units of protein molecules. There are two functional groups…

Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…

A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…

Q: 5.You are designing a protein that needs to hydrogen bond to the cell membrane, but never enter the…

A: The membrane proteins are divided into integral membrane proteins and peripheral membrane proteins.…

Q: Loss of native conformation by a protein: a) is always reversible b) is always irreversible c)…

A: The conformation in which a molecule is active biologically is known as native conformation. In the…

Q: 7. What type of bond is formed between the hydroxyl group of one nucleotide and the phosphate group…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: 3. Most protein sequences consist of a mix of hydrophobic and polar amino acids. In a sentence or…

A: The standard amino acids incorporated ribosomally into proteins are of four types based on the…

Q: 8. The existence of a concentration gradient of glucose across a membrane means that there is a high…

A: Given: The existence of a concentration gradient of glucose across a membrane. Plasma membrane is…

Q: . During a wound infection, the bacteria Clostridium perfringens produces collagenase, an enzyme…

A: As per our guidelines, we are supposed to answer only one question. Kindly repost other questions as…

Q: 2. By using the concept of endomembrane system, explain how plasma membrane involves in the protein…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 3. If a cell has a greater number of protein carriers, the rate of facilitated diffusion across the…

A: Facilitated diffusion, is the process of transport of molecules or ions via specific transmembrane…

Q: 10. Which of the following molecules is most likely to passively diffuse across the plasma membrane?…

A: Introduction Passive transport is a form of membrane transport in which molecules are transported…

Q: 4.Saturated and unsaturated fatty acids differ in the------- Your answer 7-A phospholipid has a head…

A: Saturated lipids have single bond within them and are solid in nature while unsaturated lipids may…

Q: 5. Active transport allows cells to maintain higher concentrations of many different molecules than…

A: Membrane transport of polar or charged species requires additional help from channels or transporter…

Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…

A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions…

Q: During protein synthesis, which of the following are involved in the steps that take place in the…

A: Protein synthesis takes place via a process called translation . Before translation mRna have to be…

Q: 1. Draw the general structure of glycerophospholipids and designate the site for variation in head…

A: Lipids are non-polar hydrocarbons, like fatty acids (FA), waxes, sterols, fat soluble vitamins (A,…

Q: Which membranes can proteins translocate across when they are being sorted/transported in a cell?…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: 3. What forces in the polypeptide chain occurs to make a binding site. Also give the role of AA…

A: proteins are classified into different structural levels like, primary, secondary, tertiary and…

Q: Can you please answer these two questions

A: The plasma membrane is selectively permeable. It allows only selected molecules to pass through the…

Q: 6. Explain what effect the soap had on the mixture. Did the oil and water mix better? Refer to the…

A: Molecules which do not interact with water are called non-polar or hydrophobic and water loving…

Q: 9. Proteins synthesized in the rough endoplasmic reticulum are most often intended for: A. packaging…

A: The correct option is E.

Q: 1. Please come up a peptide sequence for the two proteins shown in the diagram. Multi-pass…

A: Amino acid sequencing is the process of determining the arrangement of amino acids in proteins and…

Q: 9. Which of the following molecules cannot be found in cell membrane? A. Triglyceride B. Cholesterol…

A: The cell membrane, commonly known as the plasma membrane, protects the cell. It is found in all…

Q: 9. Describe the role of phospholipids in the formation of 'phospholipid bilayers'- the ideas of…

A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid…

Q: 4. Describe three ways that glycans turn over.

A: Older broken-down proteins are replaced in the cell refer as protein turnover. various proteins…

Q: 2 What Role Does the Amino Acid Sequence Play in ProteinStructure?

A: Proteins are the building blocks of the body. It plays an essential role in the body. Many enzymes…

Q: 1. What are the differences/ similarities between the followings: - (a) Elastase and Chymotrypsisn;…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: 1. Predict the membrane orientation of a protein that is synthesized with the following features:…

A: The insertion of membrane proteins in their right orientation is decided by multiple sequences that…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Q: 11. Why is cell membrane said to be selectively permeable? * A. because of the polar nature of tail…

A: The plasma membrane which is also known as cell membrane is the membrane found in all the cells that…

Q: 17 What locks all transmembrane proteins in the bilayer? a) Chemical bonds that form between the…

A: Introduction: Membrane proteins are protein molecules that are attached to or linked with the…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: 8) If you only wanted proteins that were attached to the plasma membrane, how might you change this…

A: BCA protein assay is a method of protein quantification after extracting the protein from the cell.…

Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…

A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…

Q: 7. Explain the differences between integral and peripheral membrane proteins.

A: The plasma membrane is composed of phospholipid bilayer in which proteins are present as small…

Q: 3. The electronic photograph shows an organelle, which is a large polyprotease complex- consisting…

A: The eukaryotic cell is compartmentalized into various subcellular compartments that perform…

Q: What would happen to the cytoskeleton if you replaced all of the normal ATP in cells with a chemical…

A: The cytoskeleton is a dynamic network make up of actin polymers and associated with actin binding…

Q: 2. What is the difference between storage lipids and membrane lipids? Describe why membranes

A: Since you have asked multiple questions, according to our guidelines we are eligible to answer only…

Q: 1. The chains of several cell membrane-bound proteins wind back and forth through the cell membrane,…

A: Given that the chains of several cell membrane-bound proteins wind back and forth through the cell…

Q: 1. The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…

A: Answer:- The process in which the peptide bonds formation occur in between the ribosome called…

Question

Please only do number 2. Thank you

1. Describe how cilia and flagella bend.
2. The polypeptide chain that makes up a tight junction weaves back and forth through the membrane four times, with two
extracellular loops, and one loop plus short C-terminal and N-terminal tails in the cytoplasm. What would you predict
about the amino acid sequence of the tight junction protein?
3. Draw a simple phospholipid bilayer. Label the areas of the membrane that are hydrophobic and hydrophilic.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following are glycoproteins whose function is affected by the common cold birus? a. plasmodesmata b. desmosomes c. cell adhesion molecules d. flagella e. cilia
1. Imagine a hypothetical situation in which an animal cell such as a hepatocyte or a macrophage would completely lose the ability to produce membrane proteins. a) What would be the structural and molecular organization of such a hypothetical cell? b) How do you think this situation would affect the function of that cell? Be as thorough as you can.
1. Explain in detail how amino acids can be transported across the plasma membrane 2. By using the concept of endomembrane system, explain how plasma membrane involves in the protein synthesis of a cell. 3. With suitable examples, compare the structural and functional differences between a fibrous and globular protein. 4. A person suffers from a skin condition and loss of muscle. A doctor suspects the patient has protein deficiency. Justify why the doctor thinks so.
1. Compare the different ways that substances move across membranes. 2. Imagine that you have given blood, but a sample of your red blood cells is accidentally stored in distilled water instead of a saline solution. Predict and explain what would happen to the cells. Use a diagram to support your answer. 3. Explain the fluid mosaic model of a cell membrane, use a diagram to explain your answer. Then briefly describe the 4 functional roles membrane proteins play, also add diagrams to your answer. 4. Describe the difference between an unsaturated fat and a saturate fat. Include information about molecules, bonds, and properties of the substance as a whole.
1. Which of the following BEST describes the composition of the plasma membrane? a.Double layer of phospholipids, protein, carbohydrate and some cholesterol b.Lipoproteins in which triglycerides are a major component c.Cholesterol, proteins, and a small but significant amount of lipids d.A lipid bilayer formed mainly from cholesterol with protein attached to both sides 2.Which of the following is TRUE about the movement of water across membranes? a.Water migrates to an area of low salt concentration. b.Water migrates to an area with high lipid content c.Water migrates to an area with high salt concentration. d.Water migrates into and out of the cell at equal rates. 3. Which of the following molecules/ material can freely pass through the cell membrane's phospholipids? a.carbon dioxide b.lipids c.oxygen molecule
1.Which component of the plasma membrane allows the immune system to differentiate between body cells and foreign cells or tissues? a.integral proteins b.carbohydrates c.cholesterol d.peripheral proteins e.phospholipids 2.Cyanide is a chemical that affects the function of mitochondria affecting the energy processing of cell. What will happen to a cell if it was exposed to an isotonic solution of cyanide? a.the cell will die b.remain the same c.mitochondria will shrink d.mitochondria will swell
1. Illustrate the structure of the cell membrane. Include all important molecules and describe what each type of molecule does
2. Use the following vocabulary to label and draw a cell membrane: cytoplasm (cell lumen) extra-cellular fluid hydrophobic hydrophilic polar head non-polar tails a) How many O-H groups are there? And are the O-H areas of sucrose polar or non-polar? b) What is the term that is used to discuss how tightly or loosely an atom's nucleus has a hold of its valence electrons? c) Do you think any water molecules move in the opposite direction of the arrow? Explane your answer in detail.
1. During a wound infection, the bacteria Clostridium perfringens produces collagenase, an enzyme that breaks apart collagen, as one of its virulence factors. What do you predict would be the most likely outcome of this collagenase production? A. Breakdown of connections and structure of the extracellular matrix B. Blockage of signal transduction C. Lysis of the phospholipid bilayer of cells D. Degradation of tight junctions 2 The primary cell wall of plants is made mostly of the structural carbohydrate ______, which is a polymer of the monosaccharide glucose. A. starch B.cellulose C.glycogen D.peptidoglycan 3. The protein integrin binds to actin filaments and, by binding to proteins like fibronectins, connects to collagen. In this manner, integrin ______. A.controls the permeability of the cytoplasmic membrane B. suspends organelles within the cytoplasm C. provides a direct linkage between the cytoskeleton and the extracellular matrix D. helps keep individual cells in place and…
3. The protein integrin binds to actin filaments and, by binding to proteins like fibronectins, connects to collagen. In this manner, integrin ______. A.controls the permeability of the cytoplasmic membrane B. suspends organelles within the cytoplasm C. provides a direct linkage between the cytoskeleton and the extracellular matrix D. helps keep individual cells in place and connects adjacent cells to each other
From the image, what is the normal function of the missing structure? A. A lipid bilayer controlling the movement of substances into and out of the cell B. A motor protein that "crawls" along microtubules to contract and release them, which provides movement C. A cytoskeleton element composed of tubulin subunits to provide structure for movement of the cell
1) All of the following are functions of proteins within a membrane except __________. A)Maintaining the fluidity of membranes B)transport ions and other polar substances C)receptors to bond molecules outside of the cell D)helping the body to recognize its own cells 2) Which of the following organelles is not part of the endomembrane system A)mitochondria B)golgi apparatus C)lysosomes D)rough endoplasmic reticulum 3) Which cytoskeletal element is composed of actin and is involved with muscle contraction and provided strength to cells during stretching and compression? A)Microfilimants B)Intermediate filaments C)Microtubules D)Flagella