28. The muscle has three muscles that act together to simultaneously flex the hip and extend the knee а. А b. В с. С B d. D e. E

Q: 13. A way we can measure the health of an ecosystem is to look at the change in number of species…

A: Answer

Q: Describe the Gastrulation in Caenorhabditis elegans.

A: The study of embryo development is known as embryology. This covers the transformation of a…

Q: CASE 1: A dying patient is experiencing agony and there is no medical relief available. Her life can…

A: Euthanasia: Euthanasia is the deliberate ending of a person's life in order to relieve pain and…

Q: Determine which amino acid is formed from the following mRNA codon: GUA.     a aspartic acid b…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: During DNA replication, the enzyme called _______ unwinds the DNA do

A: The helicase enzyme unwinds the DNA double strand helix by breaking the hydrogen bonds present…

Q: Cyanobacteria are photosynthetic prokaryotes that are likely responsible for generating the gen-rich…

A: Answer ::   An alternative pathway for glucose oxidation is the pentose phosphate pathway (PPP). In…

Q: Discuss the societal impacts of the use of transgenic Golden Rice. What are some potential benefits…

A: INTRODUCTION A genetically modified organism is a living organism whose DNA has been altered via the…

Q: How do the following types of viruses replicate (where does replication occur within the host cell,…

A: Dear student, as per the guidelines, I will answer the first three options. Please post the…

Q: In regards to MITOSIS, give the order of the following events in terms of chromosome number.…

A: The cell division is the process that involves production of two or four daughter cells from a…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Match the STD with their descriptions.   Question 24 options:   leading cause of PID; bacteria…

A:

Q: What is purpose of the GMO-positive control DNA in the experience?

A: Introduction :- GMOs, or genetically modified organisms, are organisms (plants, animals, or…

Q: Equipment or materials used in immobilizing and separating cells of streak, pour and spread method.

A: Answer :- We need to understand one by one are as follow :-  * Equipment or materials used in…

Q: Explain how Hepatitis B, C, D and G occurs and what is the etiology of each one. Explain how AIDS…

A: In patients with weaker immune systems, such as people living with HIV, opportunistic infections…

Q: Question 8: What type of cell junction allows very rapid communication between cells by allowing…

A: Introduction :- Cytoplasm is a thick liquid that fills each cell and is surrounded by the cell…

Q: Differentiate Protostomes from Deuterostomes in terms of germ layer formation

A: The most significant difference between protostomes and deuterostomes arises due to the…

Q: Explain the evidence that our species originated in Africa.

A: Introduction :- A species is commonly defined as a collection of organisms that can reproduce…

Q: Identify the mollusc group that includes each of these examples: garden snail, clam, and squid.

A: Taxonomy is the study of organism categorization, it is the grouping (division) of all known species…

Q: Formulate a working hypothesis about using intangible model in visualizing enzyme structure

A: The evolving technology of computer autofabrication makes it possible to produce physical models for…

Q: The position where a spinal cord enters the skull provides evidence about whether a fossil…

A: Skeletal features are important in describing evolutionary changes.

Q: In guinea pigs, rough coat is dominant (R) to smooth coat (r), and black coat (B) is dominant to…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: what plant process involved in your experiment in transpiration in colored rose aside from…

A: The plant body is complex, made up of several systems. Each system in the body has a distinct…

Q: explain how p53 functions in a cell that sustained DNA damage to prevent progression of that cell…

A: p53 induces numerous different target genes and blocks the different stages of progression of tumor…

Q: Surgical method of sterilization in a woman involves cutting and tying of: A. Ureter B. Uterus C…

A: Introduction - All forms of life and other biological agents such as prions existing in or on a…

Q: Vhich colorectal cancer screening tests are used in men over the age of 50? O Colonoscopy O All of…

A: Cancer. It is a disorder characterised by unregulated cell multiplication. Any cells, including…

Q: How is the photic energy absorbed by chlorophyll transfered to ATP molecules in…

A: Photons of light energise the electrons in the chlorophyll molecule. The electrons are attracted by…

Q: why do gray squirrels prefer crushed walnuts than walnuts with shells?

A: Normal squirrels have four front teeth that never stop growing and make it easy for them to eat…

Q: Lab Day & Time - Negative End Marker Crime Suspect Suspect Standard Scene # 1 # 2 wells og aib d to…

A: As per Bartleby guidelines, we can answer a maximum of three subparts of the question, so, kindly…

Q: Primaquine is a drug used in the antimicrobial prophylaxis of: O Meningitis O Tuberculosis Malaria O…

A: Answer :- Option (C) is correct. - Malaria.

Q: Identify the critical ecological roles played by prokaryotes and briefly describe their…

A: Prokaryotes are organisms with cells that lack a well-defined nucleus.

Q: What is the primary function of the external auditory meatus? a. amplify sounds b. funnel sounds…

A: External auditory meatus also called as external acoustic meatus, is about 25mm (1 inch) in length…

Q: Glucose in urine is an indication of all of the following, except blood glucose levels are high Tm…

A: Glycosuria  It is a condition in which a person's urine contains more sugar, or glucose, than it…

Q: Question 17 Osmosis is the movement of across a selectively permeable membrane. O sugars O oxygen O…

A: Introduction Semipermeable membrane:- It is a type of biological or synthetic, the polymeric…

Q: Which of the following true of active immunity? Is considered to provide short term protection O…

A: Ans: Active immunity results when the exposure to disease organism stimulate the immune system to…

Q: Order the path of light through the eye.   Question 68 options:   retina   lens   cornea…

A: The path of light through the eye begins with the objects viewed and how they produce, reflect or…

Q: which laboratory method can be used to quantify levels of mRNAs expressed in samples of two…

A: Biological approaches are a well-developed field in process technology for treating a wide range of…

Q: The resting membrane potential of a cell is the consequence of which of the following concentrations…

A: Introduction - The voltage across a cell membrane during its resting state is called the resting…

Q: How is the photic energy absorbed by chlorophyll transfered to ATP molecules in…

A: The process through which light is absorbed twice, once for each photosystem, and ATP is produced is…

Q: Chemiosmosis

A:

Q: What information can be obtained from DIS80 primer Blast ? A Respect length and number in alleles…

A: Primer-BLAST used for design a new target-specific primers in one step . Primer BLAST check the…

Q: errors

A: Genetic disorder- it occur when a mutation affects our genes or chromosomes. it can affect one or…

Q: how does we know that trees or plants are transpiring base on the experiment of transpiration works…

A: Introduction Transpiration:- It is the process of the loss of water in the form of water vapor from…

Q: Discuss, the adaptations that downy mildew (plant) has evolved to invade and manipulate the hosts…

A: Downy mildew  Is a fungal infection. Causative agent : phylum Oomycota    Environmental condition…

Q: Question 1. Which of the following is never found in prokaryotes? A. Ribosomes B. DNA Polymerases C.…

A: Introduction :- Ribosomes, also known as Palade granules, are macromolecular machines that perform…

Q: Discuss in details, the adaptations that Orobanchaceae (plant) has evolved to invade and manipulate…

A: Introduction Orobanchaceae:- It is a family of mostly parasitic plants of the order Lamiales, It is…

Q: What molecules or structures are present in cell that might interfere with DNA extraction?

A: DNA extraction is a method used to purify DNA from a sample. Here seperation of DNA occur from…

Q: Select all that are true about DNA gel electrophoresis O This technique can be used to separate DNA…

A: The gel electrophoresis is routinely used technique in molecular biology laboratories that helps in…

Q: correct

A: Telomeres are present at the end of the chromosome strand and these are the repeated DNA sequences…

Q: Homo floresiensis fossils were discovered in_____ . a. Australia c. Indonesia b. China d. South…

A: The discovery of Homo floresiensis was largely unexpected, as most previous evidence suggested that…

Q: a. We have a molecule 2,3-bisphosphoglycerate (BPG), which is a negative allosteric modulator for…

A: Human red blood cells, or erythrocytes, contain the most 2,3-bisphosphoglycerate. It binds oxygen to…

Muscle Action

A change in the body or a bodily organ as a result of its functioning is referred to as an action. Muscle action can be defined as the specific movement of a bodily part generated by the contraction of a muscle. The muscle proteins actin and myosin are the important contractile proteins involved in muscle action. Muscle contraction, in addition to movement, serves several other important functions in the body, including posture, heat generation, and joint stability. Muscle contraction maintains posture, which includes standing and sitting.