3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme Hpall. However, the enzyme is not cutting at the site to generate expected fragment cleavage. What may the reason(s)?

3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme Hpall. However, the enzyme is not cutting at the site to generate expected fragment cleavage. What may the reason(s)?

Name: 3) Analysis of the sequence of a DNA fragment shows the presence of r
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site forthe enzyme Hpall. However, the enzyme is not cutting at the site to generate expectedfragment cleavage. What may the reason(s)?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?b. If you prepared genomic DNA from a tissue sample containing millions of cells, would the fragments produced by partial digestion of DNA fromall of these cells be the same or different?
A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HpaII (recognition sequence is CCGG)
the restriction enzyme NotI recognizes the following sequence : 5'-GCGGCCGC-3' . On average, how oftern should this enzyme cleave DNA?
The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage λgenome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.
The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage l genome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.
Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?
A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HindIII (recognition sequence is AAGCTT)
Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.
Refer to the succeeding diagram of two DNA samples (A, B) with the specific restriction enzyme(RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNAsample A and introduced an additional restriction site. 1. Design two (2) DNA probes to be used in RFLP analysis involving these two DNA samples.Draw/illustrate the region(s) in the DNA molecule which you will use as reference(homologous) sequences in the design of the probes, THAT -a. Will reveal RFLP polymorphism between the DNA samples after probedetection/visualization; andb. Will not reveal RFLP polymorphism between the DNA samples
A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. BamHI (recognition sequence is GGATCC)