Need help 3' splicesiteGU-richsequenceIntronPAS(AAUAAA)PromoterTranscribedRegionExon 1Exon 2SubmitABCDEO O OFGHO1Clear form The long horizontal line represents a portion of a genome centered around agene. Each bracket points to a specific part of a hypothetical gene. Match eachgene part to its corresponding letter. You may have to scroll right to see A-J.A3' splicesiteGU-richsequenceIntronA-ATG-BGTATG start codonBCDCA-AGDEFGGH1★

The central dogma theory is an important concept in molecular biology that explains the flow of…

Answered: 3' splice site GU-rich sequence Intron…

Science

Biology

3' splice site GU-rich sequence Intron PAS (AAUAAA) A O B о O C O D E O F O O G H I

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Related questions

Q: The energy to hydrolyze (split) water comes from: A. an oxidized chlorophyll B. a reduced…

A: The splitting of water in photosynthesis is a crucial step that not only provides oxygen but also…

Q: Build four flash cards, one for Chocolate, MacConkey, TSA-blood and CNA-blood agar media. Your Mac…

A: The term "media" in the field of microbiology describes the materials or concoctions accustomed to…

Q: Examine the table of characters given for four different species of flower. Species A Species B…

A: Traits are identifiable traits or qualities of an organism that can be measured or observed, and…

Q: 1. The pH of the stomach is integral to how food digests. Explain why this is and what can happen…

A: Digestion refers to the process of mechanically and enzymatically breaking food into substances that…

Q: Propliopithecids vs. Parapithecids. Adapids and Omomyids. Dryopithecus and Oreopithecus. With the…

A: Primates are social creatures that live in various sized groups. They communicate with one another…

Q: In the figure below, F represents G F & G unite to form F and G represents LA O lateral horn;…

A: Spinal cord is divided into the regions of gray matter and white matter, gray matter is further…

Q: In the photosynthetic formation of ATP, the enzyme ATP synthase couples the synthesis of ATP to: A.…

A: Cellular respiration involves the breakdown of glucose and the production of energy in the presence…

Q: Steps Step 1 Step 2 Step 3 Step 4 Step 5 Enzyme/s involved Protein Metabolism Electron carriers ATP…

A: The many chemical processes and cellular pathways associated with the production (anabolism) and…

Q: Black fur in mice (B) is dominant to brown fur (b). Short tails (T) is dominant to long tails (t).…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Leopards are seen in a variety of patterns: spotted, black, and tan. Examine the following crosses…

A: Leopards are seen in a variety of patterns: spotted, black, and tan. Examine the following crosses…

Q: 1)You can see something at 10x but not at 40x or 100x, what do you do? 2)Your microscope has light,…

A: Using a microscope, a scientist can examine specimens or things that are too small to be seen by the…

Q: 1. You are given 2 unlabelled beakers, one filled with a solution of salt water with 20%…

A: Osmosis is a process in which the movement of water molecules occurs from a lower solute…

Q: Q4.4. In a certain species of flowering plant, the allele for red petal color is dominant and the…

A: Genes are the hereditary units of DNA responsible for controlling a particular trait…

Q: How many clades are there in this phylogeny?

A: A phylogenetic tree is a diagram which is used to represent and study evolutionary relationships…

Q: The image shows a transverse section of an intestinal wall at 100 x magnification. Identify the…

A: The intestinal tract's small intestine comes after the stomach, which is subsequently followed by…

Q: blood type B 18₁ AB blood type A blood type AB blood type O 1^₁ 11 IB IA Genotype Phenotype Genotype…

A: The parent belonging to the blood group A has genotype IAI and the parent belonging to the blood…

Q: True or False. Explain. Nucleosomes are aided in their formation by the high proportion of…

A: The statement given relates to the formation of nucleosomes, which are crucial units of DNA…

Q: Scientists can measure evolution in both individuals and in populations. True False

A: Evolution is the net directional change or any cumulative change in the characteristics of organism…

Q: Match the term to its best definition. molecule with high-energy bond that carries amino acid to…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis…

Q: Calculate the fractional saturation for emperor penguin myoglobin, which has a p50 value of 2.5…

A: Fractional saturation of myoglobin refers to proportion of mygloglobin that is bound to oxygen. p50-…

Q: ribe the role that phosphorylation plays in glucose metabolism

A: Phosphorylation is the process of attaching a phosphoryl group to molecules. Dephosphorylation, or…

Q: How are tarsiers different from all other primates? How are African-Eurasian monkeys different from…

A: Primates are a group of mammals that includes humans, apes, monkeys, and lemurs. They are…

Q: jumper ant is 2n = 2. XX is 2n = 4. has one pair of homologous chromosomes. has the same number of…

A: Mitosis is a type of cell division that occurs in normal cells. This division is responsible for…

Q: Part D. Read the clues for the jumbled words that appear below. Unscramble the words and place them…

A: Photosynthesis and respiration are the major processes in nature. Photosynthesis occurs in plants…

Q: If the shown serial dilutions are performed, starting with a 5M stock of sodium acetate, what is the…

A: Serial dilution is a laboratory method used in biology to dilute a concentrated substance in a…

Q: Adherens junctions link together adjacent cells in an epithelial sheet through the lateral…

A: Adhersion junctions are mainly protein complexes that occur at cell cell junctions, also at cell…

Q: Deforestation can have many local effects. For example, is the amount of light that is reflected off…

A: Deforestation is a severe problem with numerous local implications. The loss of trees, which absorb…

Q: Below are examples of exposures. Match the examples with the type of exposure. Season __…

A: Environmental exposures include a range of factors that can have an effect on a person's health,…

Q: Part 1 ( Select the correct conversion factor needed for this calculation: Choose one: 1 mg…

A: Acetaminophen is a painkiller which is used to treat mild to moderate pain from headaches, muscle…

Q: Several hypotheses have been proposed as explanations for hominin evolution and the emergence of…

A: A terrestrial locomotion where tetrapods move by their two rear limbs or legs is known as…

Q: Describe at least one cranial and one postcranial trait that suggests Ardi was bipedal.

A: An early human species known as Ardi, or Ardipithecus ramidus, lived in Ethiopia around 4.4 million…

Q: Blood pH and cerebrospinal fluid pH are affected by carbon dioxide content. This enables the…

A: Carbon dioxide plays a significant role in regulating the pH of both blood and cerebrospinal fluid.…

Q: Which of the following is a difference between Adapoids and Omomyoids? A. Adapoids had a bony…

A: The question addresses a key differentiation between two groups of early primates, Adapoids and…

Q: QUESTION 23 Which of the following is NOT an assumption of the Hardy-Weinberg Equilibrium principle?…

A: It assumes conditions under which alleles frequency in the population remains constant.

Q: Which of the following is not part of the eukaryotic RNA processing? 5' capping initiation All are…

A: The production of RNA from DNA is known as transcription. Eukaryotic RNA undergoes massive…

Q: Describe the structure of a bacterial genome, and explain how it differs from a eukaryotic genome.

A: Bacteria are widespread, mostly free-living creatures with only one biological cell. They constitute…

Q: Primates typically have multiple offspring each year and these offspring mature very quickly and…

A: Primates have forward-facing eyes with overlapping fields of view that allow depth perception. The…

Q: 5. In the diagram, structures I and II refer respectively to the: amino and carboxyl functional…

A: Functional group:-A functional group is a particular group of atoms or a structural arrangement of…

Q: The X's correspond to the missing information. You need to determine what those X's represent DNA…

A: DNA, RNA, and protein are the three principal molecules that store and transmit genetic information…

Q: What is one anatomical difference between Australopithecines and other early hominins, such as Ardi?…

A: The answer is: B. Ardi had a divergent big toe while the Australopithecines had non-divergent big…

Q: Can Hydrophobic Interaction Bead Chromatography be used to isolate Protein X from muscle tissue if…

A: Chromatography is a vital biophysical technique for separating, identifying, and purifying the…

Q: The _____ is an area of the hypothalamus that initiates eating and controls several aspects of…

A: The brain and behavior are intricately connected and interconnected. The brain gets information and…

Q: Zone or maturation Xylem Epidermis Protoderm Phloem Root hair Procambium Endodermis Cortex Zone of…

A: This is the ultrastructure of root. Root is the lowermost part of the plant body which inserts…

Q: Our species, H. sapiens, derived from: OH. floresiensis. OH. ergaster. OH. habilis. H. rudolfensis.

A: Homo sapiens, the species to which all modern humans belong, is unique in the Homo genus. Its…

Q: Which characteristics correctly describe the cytoskeleton? provides structure for the cell structure…

A: Cytoskeleton:Intracellular network of protein filaments in the cytoplasmProtein filaments are…

Q: Interpret the following flowgram and write down its sequence 3 2 1 A T Answer: ATACGGC G C talu

A: DNA is made up of nucleotides which is its monomer. Each nucleotide is made up of phosphate group,…

Q: When DNA sequence from a diploid individaul is of a 1,0000 nucleotide region. FInd the # of…

A: To calculate the number of pairwise differences you can expect between two alleles in a diploid…

Q: Which of the following mechanisms of evolution would have the SMALLEST impact on allele frequency…

A: An allele is one of two forms of a gene. Allele frequency describes how common an allele is in a…

Q: Design an experiment that will allow to determine if there is fungal adaption to thermal soils -Draw…

A: In various ecosystems, soil temperature plays a pivotal role in shaping the composition and…

Q: During a pulse-chase experiment with secreted proteins, the proteins are synthesized for a short…

A: Pulse-chase experiment is used to study the dynamics of synthesis of proteins, maturation and…

Question

Need help

3' splice
site
GU-rich
sequence
Intron
PAS
(AAUAAA)
Promoter
Transcribed
Region
Exon 1
Exon 2
Submit
A
B
C
D
E
O O O
F
G
H
O
1
Clear form

The long horizontal line represents a portion of a genome centered around a
gene. Each bracket points to a specific part of a hypothetical gene. Match each
gene part to its corresponding letter. You may have to scroll right to see A-J.
A
3' splice
site
GU-rich
sequence
Intron
A
-ATG-
B
GT
ATG start codon
B
C
D
C
A-AG
D
E
F
G
G
H
1
★

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Explanation

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start codon, what is the third amino acid incorporated into the polypeptide chain?
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
A Section of a GeneAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids The section of a gene shown above (AAG ATA CAG GCT CGG TAA) is called the Answer (template or non-template) strand. It is also known as the Answer (sense or antisense) strand. The amino acids are determined from the Answer (DNA or mRNA or tRNA) strand
Which of the following sequences would NOT be found as an anticodon in a tRNA?Question 35 options: A) 3'-UAG-5' B) 3'-UGG-5' C) 3'-UAC-5' D) 3'-CUU-5' E) 3'-AUG-5'
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGC
A small section of bacterial DNA antisense strand has the following nucleotide sequence:AAT CGG TCC TCGThe tRNA anticodons for the gene sequence shown above is a. TTA GCC AGG AGC b. AAU CGG ACC ACG c. AAU CGG UCC UCG d. UUA GCC AGG AGC
Consider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequence
A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What amino acids are encoded by this sequence?