3. Given the following DNA sequences for cytochrome c, answer the question below. Amoeba Cat Shark ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTTCAT Kangaroo TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Dolphin CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT CTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT In one paragraph, using your own words, describe how you would determine which organisms are most closely related using the chart above. Be sure to use correct spelling, grammar, and punctuation B i U Font Family -AA- A FE E → ↓ tv

3. Given the following DNA sequences for cytochrome c, answer the question below. Amoeba Cat Shark ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTTCAT Kangaroo TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Dolphin CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT CTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT In one paragraph, using your own words, describe how you would determine which organisms are most closely related using the chart above. Be sure to use correct spelling, grammar, and punctuation B i U Font Family -AA- A FE E → ↓ tv

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter25: The Origin Of Life

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

1. Based on the Cytochrome C data, which organism is most closely related to humans?2. Do any of the organisms have the same number of differences from human Cytochrome C? In situationslike this, how would you decide which is more closely related to humans?3. Charles Darwin published his book On the Origin of Species in 1859. Of the different types of evidence thatyou have examined, which do you think he relied upon the most, and why?
1. Was this a valid scientific study? Please state at least two reasons for your answer
1.Identify all answer choices that best complete the question. Which of the following are “kingdoms” used for classification of living organisms? a. microbes b. animal c. plant d. protista 2. Select the best response to the question. You are reviewing a patient’s sputum culture results that have tested positive for Staphylococcus epidermidis. How do you interpret these findings? Group of answer choices a. This is part of the patient’s normal flora. b. The patient has a respiratory infection. c. The patient’s sputum is no longer sterile. d. The results are inconclusive 3. Most microorganisms in the body have the potential to cause illness. Group of answer choices true or false 4. The severity of disease produced by a pathogen is referred to as ____________. 5. Identify all answer choices that best complete the question. The ability of an organism to cause infection is determined by: a. he organism’s virulence. b.the portal of entry. c. the status of the host’s immune…
To which taxonomic group do cyanobacteria belong?a. Domain Archaea c. Domain Bacteriab. Phylum Actinobacteria d. Phylum Fusobacteria
1. All of the following are included in the six kingdoms of life, EXCEPT: * A. plantae B. archaebacteria C. protista D. monerans
Which of the following statements is correct? Please select all that apply. Select one or more: a. Parasitism between bacteria and archaea caused complex interactions that eventually gave rise to eukarya. b. While bacteria are prokaryotes, archaea are neither prokaryotic, nor eukaryotic but classified as a 3rd cell type. c. Prokaryotes are classified further based on whether they are unicellular or multicellular organisms. d. The molecular biologies of archaea and eukarya show a greater proportion of similarities than those of eukarya and bacteria. e. Prokaryotes could not make photosynthesis until chloroplast endosymbiosis evolution. f. The last universal common ancestor most likely had a primitive prokaryotic cell organization. g. Endosymbiosis of chloroplast precedes that of mitochondria.
Answer both questions please. Which of the following taxonomic groupings is most specific (i.e., contains a set of organisms that is most related/similar in nature)? a. Domain b. Class c. Order d. Kingdom e. Family Bryce is interested in examining the effect of a new drug, Enlighten, on improving the mood of college students who are about to sit for their final exams. Specifically, he is interested in determining if it has a greater effect than no drug at all. The independent variable in Bryce's experiment is ___________________. a. The mood of college students enrolled in his study b. The number of college students taking part in the research c. The type of drug (placebo vs. Enlighten) received by the research participants d. The amount of drug administered to participants in the study e. None of the above
Archaea are distinct from bacteria becausea. some archaea form methane.b. each have different rRNA sequences.c. archaea do not have peptidoglycan cell walls.d. archaea are more closely related to eukaryotes.e. All of these are correct.
Which of the following organisms is a prokaryote? a. amoeba b. influenza A virus c. charophyte algae d. E. coli
Peptidoglycan is a chemical compound found in the cell walls of (a) most viroids (b) most archaea (c) all prokaryotes (d) most bacteria (e) most eukarya
Which of the following is not a domain in the three-domain system?Question 1 options: a) Archaea b) Eukaryotes c) Fungi d) Bacteria
1. Which of the following is not an evidence that chloroplasts and mitochondria originated as prokaryotic endosymbionts of larger cells? * A. They contain circular DNA molecules not associated with proteins. B. Their membranes have enzymes and transport systems that resemble those found in plasma membranes of prokaryotes. C. Their ribosomal RNA is more similar to that of eubacteria than to eukaryotes. D. They contain their own genome and produce their own proteins. 2. Why does the endosymbiotic hypothesis maintain that chloroplasts may have at least three origins? It is because * A. Molecular systematics link the red line, green line and brown line to three different eubacteria. B. The chloroplasts of green plants show three distinct morphologies. C. The pigment composition and thylakoid arrangement cyanobacteria occur in three different arrangements. D. The phyla of algal protists can be divided into three…