3. Strand 1: The coding sequence for gene F is read from left to right. The coding sequence for gene G is read from right to left. Which strand of DNA serves as the template for transcription of each gene? Strand 2: 4. 5. 5' 3' Gene F Gene G 3' 5' In prokaryotes, a search for genes in a DNA sequence involves scanning the DNA sequence for long open reading frames. What problem would there be with this approach in eukaryotes? What do the processes of DNA synthesis, RNA synthesis and polypeptide synthesis have in common?

3. Strand 1: The coding sequence for gene F is read from left to right. The coding sequence for gene G is read from right to left. Which strand of DNA serves as the template for transcription of each gene? Strand 2: 4. 5. 5' 3' Gene F Gene G 3' 5' In prokaryotes, a search for genes in a DNA sequence involves scanning the DNA sequence for long open reading frames. What problem would there be with this approach in eukaryotes? What do the processes of DNA synthesis, RNA synthesis and polypeptide synthesis have in common?

Name: May I get help with question 3 please 3.Strand 1:The coding sequence f
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: May I get help with question 3 please 3.Strand 1:The coding sequence for gene F is read from left to right. The coding sequence for gene G is read from right to left. Whichstrand of DNA serves as the template for transcription of each gene?Strand 2:4

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 1TYK: Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a...

See similar textbooks

Similar questions

Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. please answer the 3 questions, thank you so much!
1.The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the complementary strand? * a. GCT GGC ATG b. CCT CCG ATC c. GCU GGC AGC d. CCT GGC AGC 2.What is the arrangement of mRNA transcribing the DNA triplets: TAC TAG CCG CGA? * a. ATG ATC GGC GCT b. UAC UAG CCG CGA c. AUG AUC GGC GCU d. AUG ATG GGC GCA 3. A DNA base sequence is 90 bases long. How many codons can these sequence order? * a. 270 b. 180 c. 90 d. 30 4. Which of the following statements regarding translation is true? * a. there are 3 start codons and 1 stop codon b. there is one start and 3 stop codons c. there are 3 start and stop codons d. there is one stop codon and one start codon
1. It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the removal of introns 2. This is a linkage between paired bases in the secondary DNA structure 3. It refers to the linkage between 2 nucleotides in the DNA molecule 4. Give the range of the number of nucleotides present in a single protein molecule 5. Identify the number of bases included in the nucleosome 6. It is an enzyme that cuts the bacterial plasmid at its cleavage site
The diagram below shows a section of double-stranded DNA undergoing both transcription and replication. RNA polymerase (gray oval) is bound to the transcriptional template strand and moving from left to right (arrow). The resulting RNA transcript is also shown (dotted line) with limited base pairing to the template strand. The DNA sequence is specified for a portion of the double-stranded DNA. IMAGE a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand (upper or lower) is the template for lagging strand synthesis c. Indicate the nucleotide sequence of the RNA that was transcribed from the DNA region specified by the sequence. Label the 5' and 3' ends of this sequence.
5. Consider the following DNA template strand:3’ GCA- AAA-CAA-ATA-GTG 5’Using the following sequence, identify:a. The base sequence in the DNA information strandb. Assuming that no introns are present, identify the codons present in the mRNA transcribed from the DNA template strandc. The anticodons in the tRNA that with interact with the mRNA codons in (b).d. The amino acids that will be carried by the tRNA (from c) molecules
DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence5’-CCG ATC GCA CAA-3’a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codonII. Absence of start codonIII. Due to mutationb) If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)?I. Substitution of C with GII. No changeIII. Deletion of CIV. Both I & III
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
1. Which of the following explains why prokaryotes have a bigger gene-to-genome size ratio compared to eukaryotes? A. Prokaryotic genome contains multiple promoters and repressors that control of a single gene.B. Prokaryotic genome is completely devoid of non-coding sequences.C. Prokaryotic genome contains multiple genes that are under the control of a common promoterand repressor.D. Prokaryotic genome contains one promoter region for each gene. 2. Which of the following can explain why eukaryotes have smaller gene-to-genome size ratio compared to prokaryotes?A. Genome size do not correlate with complexity in eukaryotes.B. The percentage of genes is inversely correlated with genome size in eukaryotes.C. Eukaryotic genome contains a lot of coding sequences.D. Eukaryotic genome contains a lot of non-coding sequences.
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA. A.Adenovirus DNA hybridization B.Complementation C.Mutagenesis D.Sequencing 1 分 5 In 1998 Fire, Mellow and coworkers discovered that in C. elgans: A.long double-stranded RNAs can cause sequence-specific gene silencing B.short single-stranded RNAs can cause nonspecific gene silencing C.double-stranded RNAs of any length can cause nonspecific gene silencing D.long single-stranded RNAs can cause sequence-specific gene silencing 1 分 6 RNAi seldomly spreads to: A.the neurons B.the liver C.the brain D.the heart
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'