1. Using the diagram below: a. Label the process identified by each arrow. b. Label the diagrams below with each of these parts (note the arrow on Gene 2) Is this a prokaryotic or eukaryotic cell? C. Gene 1 Per CLOC Gene 2 start codons transcription terminators stop codons S... WORD BANK P introns exons promoters

1. Using the diagram below: a. Label the process identified by each arrow. b. Label the diagrams below with each of these parts (note the arrow on Gene 2) Is this a prokaryotic or eukaryotic cell? C. Gene 1 Per CLOC Gene 2 start codons transcription terminators stop codons S... WORD BANK P introns exons promoters

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter4: Cells

Section: Chapter Questions

Problem 2TYK: Eukaryotic and prokaryotic ribosomes are similar in that: a. both contain a small subunit, but only...

See similar textbooks

Similar questions

3. Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
Figure 14.10 In eukaryotic cells, DNA and RNA synthesis occur in a separate compartment from protein synthesis. In prokaryotic cells, both processes occur together. What advantages might there be to separating the processes? What advantages might there be to having them occur together?
Eukaryotic and prokaryotic ribosomes are similar in that: a. both contain a small subunit, but only eukaryotes contain a large subunit. b. both contain the same number of proteins. c. both use mRNA to assemble amino acids into proteins. d. both contain the same number of types of rRNA. e. both produce proteins that can pass through pores into the nucleus.
1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
1. A tRNA to which the correct amino acid has been attached is called?
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
The following video shows the translation process in eukaryotes. https://www.youtube.com/watch?v=qIwrhUrvX-k Based on the video, which signal serves a similar function as the Shine-Dalgarno Sequence in prokaryotes? A. The promoter region B. 5' CAP C. Poly(A) tail D. Start codon
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table