5. Which end corresponds the last amino acid of a polypeptide chain? A. The 5' end of a DNA coding sequence B. The 5' end of the noncoding template strand C. The 5' end of an mRNA D. The N-terminus end of the polypeptide chain E. Then end that has a methyl-guanine added onto it during mRNA processing

5. Which end corresponds the last amino acid of a polypeptide chain? A. The 5' end of a DNA coding sequence B. The 5' end of the noncoding template strand C. The 5' end of an mRNA D. The N-terminus end of the polypeptide chain E. Then end that has a methyl-guanine added onto it during mRNA processing

Name: 5. Which end corresponds the last amino acid of a polypeptide chain?A
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 5. Which end corresponds the last amino acid of a polypeptide chain?A. The 5' end of a DNA coding sequenceB.The 5' end of the noncoding template strandC. The 5' end of an mRNAD. The N-terminus end of the polypeptide chainE. Then end that has a methy

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

5)Which type of nucleic acid would have the sequence "ACCGAUUG"? a)DNA b)mRNA c)Another type of nucleic acid d)More information is needed
1. What amino acids are specified by the following base triads on DNA?a. TCAb. CCtc. GGC d. GATe. TTA 2. What amino acids are specified by each of the following codons on an mRNA molecule? a. CAU b. UCC c. AGA d. GCG e. AAA
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A. 5’-CGU-UAC-AGG-CCA-3’ B. 3’-CGU-UAC-AGG-CCA-5’ C. 5’-CGT-TAC-TGG-GCA-3’ D. 3’-CGT-TAC-TGG-GCA-5’ 2. Which is the correct amino acids using the mRNA strand of 5’-AUG-CAU-CAA-3’? A. MET-HIS-GLN B. GLN-HIS-MET C. MET-GLN-HIS D. HIS-MET-GLN
Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template strand from which the mRNA was synthesized; [2] give the peptide synthesized by the mRNA. a. 5 ' UUG CUC AAC CAA 3 'b. 5 ' AUU GUA CCA CAA CCC 3
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
1.The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the complementary strand? * a. GCT GGC ATG b. CCT CCG ATC c. GCU GGC AGC d. CCT GGC AGC 2.What is the arrangement of mRNA transcribing the DNA triplets: TAC TAG CCG CGA? * a. ATG ATC GGC GCT b. UAC UAG CCG CGA c. AUG AUC GGC GCU d. AUG ATG GGC GCA 3. A DNA base sequence is 90 bases long. How many codons can these sequence order? * a. 270 b. 180 c. 90 d. 30 4. Which of the following statements regarding translation is true? * a. there are 3 start codons and 1 stop codon b. there is one start and 3 stop codons c. there are 3 start and stop codons d. there is one stop codon and one start codon
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
1. What does it mean when we say the genetic code is redundant? a) A single codon can specify the incorporation of more than one amino acid. b) The genetic code is universal (the same for all organisms). c) The genetic code is different for different organisms. d) More than one codon can specify the incorporation of the same amino acid.
1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7 (b) "In this mutation, the UGG codon is replaced with UGA." missense mutation nonsense mutation silent mutation frameshift mutation
4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA? a) RNA is synthesized in the cell in case too large a mutation damages the DNA. b) DNA has the reproductive genetic code of all cells and passes it on to RNA. c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins. d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.