3. The following segment of DNA is the template strand: 5'-.GACATGGAA.-3' a. What is the sequence of MRNA created from this sequence (indicate 5' and 3' ends)? b. What is the amino acid sequence produced by translation?

3. The following segment of DNA is the template strand: 5'-.GACATGGAA.-3' a. What is the sequence of MRNA created from this sequence (indicate 5' and 3' ends)? b. What is the amino acid sequence produced by translation?

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 4SQ: One species' DNA differs from others in its _______ a. nucleotides b. DNA sequence c....

See similar textbooks

Related questions

Q: 9 The table opposite shows the standard riplet codes for the 20 amino acids involved in protein…

A: Transcription is the process in which the DNA strand which codes for a protein and e converted to…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)

A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…

Q: 1. How many codons are there in the Original DNA sequence? 2. How many codons are there in the MRNA?…

A: Introduction When a DNA gene is disrupted or damaged in such a way that the genetic message carried…

Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: . Which of the following statements about the flow of genetic information is correct? A. Translation…

A: Genes are the basic hereditary molecules that carry hereditary information in them. They are present…

Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…

Q: 3)What would be the third amino acid produced by the DNA strand: T A C C G A G T C A C G (Hint: use…

A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…

Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…

A: According to the question, we have seen a diagram, where we have to transcribe the two new…

Q: an amino acid has a codon that ends in a pyrimidine, which of the following is not necessarily true?…

A: One of the most important property of genetic code is the code is degenerate. This means that a…

Q: 2. The percentage composition of a nucleic acid molecule found in bacterial cells is 32.3% adenine,…

A: Nucleic acids are polymers whose monomeric units are called nucleotides. Nucleotides have three…

Q: 1. What are the amino acids translated from the resulting mRNA?

A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…

Q: 8. Some antibiotics work by preventing protein synthesis in bacteria by binding to their ribosomes.…

A: Multiple choice answer is given below:

Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…

A: Introduction: Complementarity is the fundamental concept of DNA replication and transcription since…

Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid…

A: DNA is the genetic material as it contains all the information required to make all the proteins and…

Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…

A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions…

Q: 9. Create a matching (complementary) DNA sequence for the following strand: A A A A A C CGA CCGATC

A: DNA is known to be the largest biomolecule in the cell. It is composed of two polynucleotide chains…

Q: 2. What would happen if a mutation in DNA changed codon 6 in the MRNA to GUA? (This one nucleotide…

A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…

A: DNA or Deoxyribonucleic acid, is a complex molecule that contains all the genetic information which…

Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…

A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…

Q: 2. The sequence of bases in a segment of mRNA is UUUCAUAAG. Answer the following questions: a. What…

A: mRNA is the transcript that is produced during the process of transcription from DNA by the enzyme…

Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…

Q: Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins.

A: DNA/RNA are basically called as nucleic acid and it is important class of macromolecules which is…

Q: 9- Considering the structure of double-stranded DNA, which kind(s) of bonds hold one complementary…

A: Deoxyribose Nucleic acid (DNA) is the basic genetic material of life. It is made up of two strands…

A: Purines is equal to pyrimidines. So A=T C=G

Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…

A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…

Q: 3. What nucleotide sequence would bond with the following strand? ATCGCCATA VWhy? Use evidence from…

A: The biochemical substance that is carried forward from the preceding generation to the succeeding…

Q: 1. What is a mutation? A. the specific sequence of bases in a molecule of DNA B. a change in the…

A: A mutation arise spontaneously at low frequency owing to chemical instability of purine and…

Q: 5. How does silent mutation affect protein production in the cell? Silent mutation A. changes the…

A: Introduction:- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…

A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…

Q: 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…

A: Introduction: The process of copying the genetic information from one strand of the DNA into RNA is…

Q: 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…

A: 1. The messenger RNA (mRNA) is produced by the process of transcription from a double-stranded DNA…

Q: Explain the central dogma - how DNA, RNA, and proteins are related.

A: The gene is the sequence of nucleotides that require certain processes to express it into protein.…

Q: Explain the following relationship: DNA formats RNA, which makes proteins.

A: DNA and RNA are two types of nucleic acids. DNA provides the code for the cellular activities while…

Q: 1

A: INTRODUCTION:- A mutation is any change in the nucleotide sequence of DNA.Some mutations affect…

Q: 4. Use the RNA strand below and list the appropriate amino acids. AUG AGU UAC CCG GGA

A: Introduction :- Organic molecules known as amino acids have side chains unique to each amino acid as…

Q: 1. Fill in the parent and template strands of DNA below. Next transcribe the RNA from the template…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: 2. The precursor of each new nucleotide in a strand of DNA is a A) deoxynucleoside 5- diphosphate .…

A: They are the polymer of deoxynucleoside 5'-triphosphate. They are double-stranded which are wound…

Q: How are nucleotides formed?

A: Hi! As you have posted multiple questions and have not mentioned which is to be answered, we are…

Q: C A T A C G C G T A с G

A: The given figure shows the process of DNA replication. DNA replication refers to the process of…

Q: (1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each…

A: DNA and RNA are polynucleotides. Monomers of nucleic acids are nucleotides. Nucleotides are made up…

Q: 1. What are the differences between DNA and RNA? 2. What are the similarities between DNA and RNA?

A: Hereditary component of a cell which contains the information of the body and can be transmitted…

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: 10) Which statement accurately describes DNA? A) Double Helix C) Remains in the nucleus D) All of…

A: DNA is deoxyribose nucleic acid which, and contain genes also.

Q: 1. Which of the following nucleotides are the part of DNA? B) DTMP C) dUMP D) dTTP

A: We are authorized to answer one question at a time, since you have not mentioned which question you…

Q: 5. When can a mutation on the DNA cause shortening of the translation product? Give a specific…

A: Mutation is the phenomenon in which the DNA sequence is altered. This may occur spontaneously.…

Concept explainers

Intelligence

Intelligence refers to the intellectual functioning that compares a person's intelligence quotient (IQ) with other people of the same age. In other words, it is the ability to understand circumstances or situations and arrive at appropriate solutions. Both animals and plants exhibit intelligence.

Question

Please help me, this is from practice, double check your answers, previous tutors got it wrong

3. The following segment of DNA is the template strand:
5'-.GACATGGAA.-3'
a. What is the sequence of MRNA created from this sequence (indicate 5' and 3' ends)?
b. What is the amino acid sequence produced by translation?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

One species' DNA differs from others in its _______ a. nucleotides b. DNA sequence c. sugar-phosphate backbone d. all of the above
5)Which type of nucleic acid would have the sequence "ACCGAUUG"? a)DNA b)mRNA c)Another type of nucleic acid d)More information is needed
1. the position that distinguishes between DNA and RNA is 2. the carbon that the phosphate group is attached to is 3. the carbon that the base is attached to is 4. the nucleotide in a growing strand would be attached to
1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is
1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T. Determine the sequence of bases in the complementary strand of mRNA that would form next to this DNA strand. a. Write the sequence of bases in the complementary mRNA strand below.___________________________________________________________________________
4. If a DNA triplet is CGA A. What is the mRNA codon? B. What is the tRNA anticondon? C. What amino acid does the mRNA code for? 5. If 18% of the nucleotide bases in a DNA molecule are Guanine (G) A. What % of the bases are cytosine (A)? B. What % of the bases are adenine (A) and thymine (T) combined? C. What % of the bases are thymine alone?
1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
1. Discuss the difference between intron and Exon
4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA? a) RNA is synthesized in the cell in case too large a mutation damages the DNA. b) DNA has the reproductive genetic code of all cells and passes it on to RNA. c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins. d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.
1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA product when the DNA is transcribed.c. What is the resulting amino acid sequence which will result from the mRNA?
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
#4 under Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases D. new complimentary strand of DNA