(1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each nitrogenous base pairs.

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…

A: DNA strand given here with directionality is as: 5’…

Q: Gene X is expressed in the developing brain, heart, andlungs of mice. Mutations that selectively…

A: Mutations occur as a result of errors in DNA or viral replication, mitosis, meiosis, or other types…

Q: Enumerate the reagents used in extraction and isolation of RNA and their uses.

A: The purification of RNA from biological samples is known as RNA extraction. This method is…

Q: A protein has the opnino acid seruence that cates as follows: •N-terminas - Some More amino kids -…

A: Protein targeting or also called as protein localization is the process by which proteins get…

Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclase…

A: Signaling is the process of communication between the cells, and between the cells and the…

Q: Aspartic acid has a side chain bearing a carboxylic acid group; its pKą is ~4. The alpha-carboxylic…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Describe the ion dynamics of the muscle-contraction process.

A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…

Q: The pH vs charge graph for a triprotic amino acid is shown below. Please answer the following…

A: An amino acid with the ability to donate 3 protons (3 H+) is called a triprotic amino acid. The 3…

Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…

A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…

Q: When do plants usually undergo mitochondrial respiration?

A: Mitochondrial respiration is commonly known as cellular respiration. This is the process of energy…

Q: TRUE OR FALSE: 1. The 35S precursor is the precursor RNA transcript for all ribosomal RNAs except…

A: Ribosomal RNA is the component of Ribosomes which is essential for translation and forcing tRNA and…

Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions…

A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…

Q: Suppose you want to determine if excessive lipid ingestion altersgene transcription. Describe and…

A: Dietary fat is a crucial macronutrient for the increase and development of all organisms. In…

Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…

A: Enzymes are biocatalysts that increase the rate of a reaction by a factor of several. Living cells…

Q: Now let us look at a real amino acid, alanine. Fill in the chart below for each ionizable group. You…

A: Amino acids are the building block of proteins. Amino acids are consisted of carboxyl group, amine…

Q: What part of the electron transport chain is responsible for the greatest contribution to oxidative…

A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport…

Q: QUESTION; — Compare and contrast the degradation pathways of purines and pyrimidines, making sure to…

A: Nucleotides are used in nucleic acid synthesis, intermediate metabolic processes, and the breakdown…

Q: 2. The kinetic effect of purely competitive inhibitor of an enzyme: (A) Increases K, without…

A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a…

Q: In plants, under what solution conditions are Calvin cycle and gluconeogenesis enzymes most active?…

A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like aminoacids…

Q: Question 24 CH,-0-C-(CH,)14–CH, CH-0-C-(CH,)16-CH, CH3 сH, —о—р—о—сH, — сн, — N—сH, CH, What is the…

A: Depending on the strut of lipid ,they are classified as simple and complex lipid. Simple lipids are…

Q: Which of the following is the primary method by which cyclin proteins are regulated to influence…

A: A. Transcriptional upregulation and translation followed by targeted ubiquitin-mediated degradation…

Q: 8. In the Stomach: a. Is there digestion? YES or NO b. If YES, then answer i-iv to explain. If NO,…

A: Fats are esters of fatty acids , also called as lipids/triglycerides.

Q: What carbohydrate is generally detected using the Molisch test? *

A: Carbohydrates are polyhydroxy aldehydes or ketones commonly called as sugars or saccharides.…

Q: Draw the Fischer projection formula for each sugar and give the importance/use of each. D-…

A: The monosaccharides are required to form oligo and polysacharides. Monosaccharides may be aldoses or…

Q: A. Name the two proteins that induce a negative feedback in this pathway and explain why both…

A: Since, you have posted multiple questions we will solve the first question for you. If you want any…

Q: Nascent form of the mRNA  A. undergoes splicing only after capping B. is also called hnRNA C. is…

A: A. undergoes splicing only after capping B. is also called hnRNA D. participates in the spliceosome…

Q: Explain to me what factors influence permeability versus solubility?

A: To understand the factors effecting the solubility and permeability it is essential to understand…

Q: Arrange signalling cascade events in chronological order.…

A: Signaling pathways helps to respond the cells according to the external stimuli. The external…

Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…

A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…

Q: The questions ask you to identify which compounds have a specific functional group. For each…

A: Here all the compounds given are organic compounds with Carbon and hydrogen back bone structure. It…

Q: COMPLETE THE TABLE OF 10 STEP OF GLYCOLYSIS BY REFERRING TO THE GLYCOLYSIS PATHWAY

A: The chemica; interconversion steps, that is the sequence of reaction by which glucose is converted…

Q: 5. Convert each of the following 3' to 5' DNA sequences to 5' to 3' DNA sequences. a. 3' ATCG 5' b.…

A: DNA contains all the genetic information of an organism in the form of genes. These genes are…

Q: 13. Which of the following is an example for derived lipids? A. steroids B. terpenes C. carotenoids…

A: Hi! Since you have posted multiple question, we shall answer the first question for as we are only…

Q: Match lipid structures in column A with its lipid type in column B esters of fatty acids with long…

A: The question include match the following with different options. The correct options are mentioned…

Q: malate + NAD+ oxaloacetate + NADH + H+ If the pH = 7 and [malate] = 0.0010 M, [oxaloacetate] =…

A: Malate + NAD+   →Malate dehydrogenase  Oxaloacetate + NADH + H+ Above reaction is the last step of…

Q: Study the given structures below. Which of the following are enantiomers? * H- OH но- - H OH но- -H…

A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…

Q: HIN A openvellum.ecollege.com 01+| 1叩 Assignments Review I Constants I Periodic Table Part B nts.…

A: Steroids are a prominent class of lipids with structures that are completely distinct from those of…

Q: Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is…

A: Restriction digestion is a process in which DNA is cut into smaller pieces at specific sites with…

Q: LIPIDS Functions Chemical Components 1. 1. 2. Two Primary Categories of Lipids 2. 3. 3 4. Two…

A: Functions of lipids:  1. Storage of energy 2. Transmit nerve impulses 3. Structure of cell membranes…

Q: reaction as a function of substrate concentration. Ex- plain why the maximal velocity can be…

A: Enzyme kinetics is the study of the rate of enzyme catalyzed bio chemical reactions and also we can…

Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…

A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…

Q: TRUE OR FALSE 1. In the structure of Aztreonam, addition of a moiety capable of Van de Waals…

A: Aztreonam is an antibiotic like penicillin and it inhibits the peptidoglycan crosslinking enzyme…

Q: The glycerol-3-phosphate shuttle can transport cytosolic NADH equivalents into the mitochondrial…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Which of the below statements is correct regarding tertiary structure? All are correct Disulfide…

A: A protein has four structural levels of organization – primary, secondary, tertiary and quaternary…

Q: Which of the following WILL PROMOTE sol formation of neutral polysaccharide sample?   a. place the…

A: Polysaccharides are used for hydrogel formation nowadays which is diversely used in the field of…

Q: Which of the following is NOT a primary method used to regulate the activity of cyclin-dependent…

A: Cyclin-dependent kinases (CDKs) are the protein kinases which plays a  role in regulating the cell…

Q: Many malignant tumors are characterized by the activation of one or more growth-factor receptors.…

A: Malignant tumours (or "cancers") are classified as monoclonal, which means that each tumour develops…

Q: Rory’s father was working on the electrical wiring his basement. Rory noticed that his father wore…

A: Rory's father was wearing rubber gloves, which are known to be one of the defense mechanisms while…

Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample?     pectins…

A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers…

Q: lysozyme was purified through G50 beads. From your lab experience, you can determine that when going…

A: Chromatography is biochemical separation method for organic molecules or solutes of a compound…