3. Which of the following two molecules of DNA melts (into single strands) at a lower temperature (Please circle)? Why? Explain your answers in terms of the strength that holds the double helix together. DNA#1 DNA#2 5'ACTAGGCGAGCGTCGCCGCCAGC3' 5'AGGCAATAACTTACT3' 3' TGATCCGCTCGCAGCGCCGGTCG5' 3' TCCGTTATTGAATGA5’

3. Which of the following two molecules of DNA melts (into single strands) at a lower temperature (Please circle)? Why? Explain your answers in terms of the strength that holds the double helix together. DNA#1 DNA#2 5'ACTAGGCGAGCGTCGCCGCCAGC3' 5'AGGCAATAACTTACT3' 3' TGATCCGCTCGCAGCGCCGGTCG5' 3' TCCGTTATTGAATGA5’

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′
The two strands of a DNA double helix can be separated by heating. if you raised the temperature of a solution containing the following three DNA molecules, in what order do you suppose they would “melt”? explain your answer.A. 5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ B. 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’C. 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’
The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a solution containing the three DNA molecules below, in what order do you think these DNAs will "melt"? Explain 1)5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ 2) 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’ 3) 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’
5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer. Strand 1: 5′ATTATTTTAAATTTAGCGC3′ Strand 2:5′AAAAAATTTTTTTTTCCGG3′ 5.2) A newly discovered blob protein folds very rapidly in the presence of protein disulphide isomerase and peptidyl prolyl cis-trans isomerase enzymes but aggregates and never folds correctly without protein disulphide isomerase. Explain why this might occur.
Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'
DNA, the carrier of genetic information in living things, has been used in criminal justice for decades. But how, exactly, does DNA profiling work? Given a sequence of DNA, how can forensic investigators identify to whom it belongs? Well, DNA is really just a sequence of molecules called nucleotides, arranged into a particular shape (a double helix). Each nucleotide of DNA contains one of four different bases: adenine (A), cytosine (C), guanine (G), or thymine (T). Every human cell has billions of these nucleotides arranged in sequence. Some portions of this sequence (i.e. genome) are the same, or at least very similar, across almost all humans, but other portions of the sequence have a higher genetic diversity and thus vary more across the population. One place where DNA tends to have high genetic diversity is in Short Tandem Repeats (STRs). An STR is a short sequence of DNA bases that tends to be repeated back-to-back numerous times at specific locations in DNA. The number of times…
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? How many full double-helical turns does this DNA contain?
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in mm?
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your answers, show how you came up to each result?(a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in micrometer?
Which of the following statements are correct? explain your answers.A. A DNA strand has a polarity because its two ends contain different bases. B. G-C base pairs are more stable than A-T base pairs.
Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'