36. When choosing restriction enzymes for cloning a gene of interest into a plasmid, what is an important requirement? Group of answer choices The gene of interest must code for the restriction enzymes which will cleave the sequence The restriction enzyme cleavage site must overlap with a region in the gene of interest The length of the restriction enzyme cleavage site must be 6 nucleotides The restriction enzyme cleavage site must not be present in the gene of interest or antibiotic resistance marker

36. When choosing restriction enzymes for cloning a gene of interest into a plasmid, what is an important requirement? Group of answer choices The gene of interest must code for the restriction enzymes which will cleave the sequence The restriction enzyme cleavage site must overlap with a region in the gene of interest The length of the restriction enzyme cleavage site must be 6 nucleotides The restriction enzyme cleavage site must not be present in the gene of interest or antibiotic resistance marker

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 3TYK: Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning...

See similar textbooks

Similar questions

1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizes
After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGA
83. A plasmid is cut with the restriction enzyme BamH1 giving fragments of 3000 and 1000 bp as identifiedby gel electrophoresis and ethidium bromide staining. In a seperate restriction digest the enzyme EcoR1gives fragments of 1000 and 1500 bp that are apparent on the agarose gel. What is the most likely size ofthe plasmid in bp? Explain why it's 4000
35) A researcher inserted DNA fragments from an organism into expression vector plasmids and introduced the modified plasmids into bacterial cells. Which of the following methods would be an effective means of identifying which clones contain a specific gene of interest?
Restriction maps illustrate the lengths of DNA fragments between restriction sites. Which of the following information can be gathered from the analysis of restriction maps? Select all that apply. a gene sequence b presence of mutations c nucleotide sequence d disease identification
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
Table 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.a. PscI & GsuIb. ScaI, PdmI & BsaXI c.ScaI, SspI & EheI
On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide victims that are being identified, while sample D came from a hair sample brought by a mother looking for the remains of her son. (see img) i. If similar band patterns in a gel are created using the same restriction enzyme, what does that tell you about the DNA sequence of the samples? ii. In sample C, only two fragments were created. How many restriction sites (regions where enzymes cut) are present in sample C?
Chromosomal DNA fragments for molecular cloning are cut by _________, and inserted into molecular vectors (such as plasmids) using __________. a. Ligase; Restriction Endonucleases. b. Restriction endonucleases; Ligase. c. DNA polymerase 1; Primase. d. DNA polymerase 1; Ligase. e. Primase; Helicase.
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above