Restriction endonuclease and ligase are two types of enzymes used in the process of genetic engineering, i.e., the manipulation of genes. The restriction endonuclease differs from ligase in that it breaks the DNA at ends, while ligase causes the breaks in DNA from interior joins the fragments of DNA, while ligase breaks the DNA into fragments breaks the DNA at specific points, while the ligase joins the fragments of DNA breaks the DNA apart at each nucleotide, while ligase use the pieces to translate

Restriction endonuclease and ligase are two types of enzymes used in the process of genetic engineering, i.e., the manipulation of genes. The restriction endonuclease differs from ligase in that it breaks the DNA at ends, while ligase causes the breaks in DNA from interior joins the fragments of DNA, while ligase breaks the DNA into fragments breaks the DNA at specific points, while the ligase joins the fragments of DNA breaks the DNA apart at each nucleotide, while ligase use the pieces to translate

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

As you learned in this chapter,restriction enzymes are sophisticated“scissors” that geneticistsand molecular biologists routinelyuse to cut DNA for recombinant DNAexperiments. A wide variety of onlinetools assist scientists working with restrictionenzymes and manipulating recombinantDNA for different applications. Herewe explore Webcutter and Primer3, twosites that make recombinant DNA experimentsmuch easier.Exercise I – Creating a RestrictionMap in WebcutterSuppose you had cloned and sequenceda gene and you wanted to design a probeapproximately 600 bp long that could beused to analyze expression of this gene indifferent human tissues by Northern blotanalysis. Internet sites such as Webcuttermake it relatively easy to design experimentsfor manipulating recombinant DNA.In this exercise, you will use Webcutter tocreate a restriction map of human DNAwith the enzymes EcoRI, BamHI, and PstI.1. Access Webcutter at http://www.firstmarket.com/cutter/cut2.html.Go to the Study Area for…
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
Restriction enzymes are referred to as "molecular scissors", justify that
The recognition sequence for the restriction enzyme Sau3AIis GATC; in the recognition sequence forthe enzyme BamHI—GGATCC—the four internal bases areidentical to the Sau3AI sequence. The single-stranded endsproduced by the two enzymes are identical. Suppose youhave a cloning vector that contains a BamHI recognitionsequence and you also have foreign DNA that was cut withSau3AI. Can this DNA be ligated into the BamHI site of the vector,and if so, why?
Restriction endonuclease digestion of a DNA sequence yielded fragments of the following sizes: 1. 5.2 kb 2. 0.8 kb 3. 1.2 kb 4. 3.8 kb 5. 3.1 kb After gel electrophoresis, what would be the order in which these fragments would be found—the last fragment listed being furthest from the negative pole.
Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA?
After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGA
The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage) is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline. The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giving the patterns shown below. What does each pattern say about the cloned DNA? Note: pBR322, the PstI and EcoRI restriction sites are about 750 bp apart. The entire plasmid with no cloned insert is 4,361 bp. Size markers in lane 4 have the number of nucleotides noted.
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6 kb. When the 10 kb fragment is digested with BamHI, three fragments of 1, 3.5 and 5.5 kb are generated. Digestion with both enzymes yields four fragments of 0.5, 1, 3 and 5.5 kb. Draw the restriction map for the 10 kb fragment based on the data. Label the cut sites for the two enzymes, and the lengths between the cut sites.
Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA? Describe some general features of restriction sites.
Table 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.