46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA binding site D. peptidyltransferase site 47 This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48 Pre-mRNA requires specific sequences for precise __________ to occur. A. splicing b. tagging c. replication D. skipping

46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA binding site D. peptidyltransferase site 47 This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48 Pre-mRNA requires specific sequences for precise __________ to occur. A. splicing b. tagging c. replication D. skipping

Name: 46What is the A-site of the ribosome?A.exit siteb.aminoacyl-tRNA bindi
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 46What is the A-site of the ribosome?A.exit siteb.aminoacyl-tRNA binding sitec.peptidyl-tRNA binding siteD.peptidyltransferase site47This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initia

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 29CTQ: A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that...

See similar textbooks

Similar questions

We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.
A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
45. A mutation in the Duchenne muscular dystrophy gene involves the deletion of two bases and their replacement by two new bases. The deletion is shown below. AAG ↻Deleted bases The deleted bases are replaced by two guanine bases.The transcription of the mutated Duchenne muscular dystrophy gene described above results in the replacement of a Select one: a. lysine codon with a serine codon b. phenylalanine codon with a serine codon c. phenylalanine codon with an arginine codon d. lysine codon with an arginine codon
26) Eukaryotes are unable to couple transcription and translation because: A) the two processes occur in separate regions of the cell B) they do not have the specialized ribosomes that occur in bacteria C) the genetic code in eukaryotes is incompatible with the formation of polyribosomes D) the mRNA of eukaryotes do not have the appropriate spacers that polycistrons allow for polyribosomes to form E) eukaryotic mRNA molecules are monocistronic. asap please.
What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerase
Give only typing answer with explanation and conclusion 12. RNA transcripts can be modified in several ways: processing, splicing, 5’ capping, 3’ poly A tailing and RNA editing. Why are those processes important? Make sure you are able to explain how each mechanism occurs.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
summarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide. Please explain step-by-step how exactly you go from the DNA sequence given to the final answer.
A) Describe each step of the DNA REPLICATION in EUKARYOTIC organismsB) Describe each step of the TRANSCRIPTION in EUKARYOTIC organisms.C) Describe each step of the TRANSLATION. Please answer all if you can! thank you