answer the other rows please 1. This is the DNA sequence in the leading strand template. Follow the instructions given on page 77 ofmodule 3.G CC G5TGGт3'в3'AAAAA5'ATABCD 1. You are provided with the DNA sequence in the leading strandtemplate. See item number 1 in worksheet, row A.information asked for in the succeeding rows:Supply therow B: supply the bases in the complementary strand.row C: Assuming that the sequence in the row A is the template fortranscription, supply the bases of the mRNA transcript. Label the 5'and 3' ends.row D: Identify the amino acids that comprise the polypeptide chain asthe ribosome would have identified them. Just merge cells before youlabel the amino acids based on the codes. Label the 5' and 3' ends.

The complementary base pairing according to Watson-Crick model of B-DNA is as follows: 1. Adenine…

Answered: 5' T A A G A G A 3' A A A AT HA

Science

Biology

5' T A A G A G A 3' A A A AT HA

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 9SQ: Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b....

See similar textbooks

Related questions

Q: Atropine (I) and Ipratropium bromide (II) are both muscarinic acetylcholine receptor antagonists. Co...

A: Atropine and ipratropium bromide are the drug use to treat pulmonary disorders . Ipratropium synthes...

Q: A 54-year-old man presents with loss of sympathetic innervation to the left side of his head, charac...

A: There is a total of 31 pairs of spinal nerves. These are further categorised based on the region the...

Q: (See attached image) Is this an image of a plant root or plant stem? Justify your answer. Is this ...

A: This is the picture of eudicot stem. In you dicot stems there are two distinct regions apart from th...

Q: the histamine H1 receptor antagonis-

A: Histamine increases stomach acid production which causes ulcers. Antihistamine H1- receptor antagoni...

Q: The image below is an example of the results that you could expect to see from your gel. Each group ...

A: Introduction:- Molecular weight markers are a set of standards that are used for determining the app...

Q: Complete Que Questions: 1. Why did Bell's patent hold up through time?

A: Conveying over large distances will be standard, dependable, joined into different activities and su...

Q: Introduce your scenario/context- coast to coast O Define homeostasis and thermoregulation and the si...

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...

Q: 1. Compare and contrast the embryonic development of the starfish and the sea urchin.

A: Embryonic development: all the developmental processes from zygote to tissues and organs.

Q: What do you think would happen to the mouse population if the number of fox predators, such as wolve...

A: Nothing will happen according to the options available in the question.

Q: e coded information in a DNA molecule directly determines the formation of ____________. * a. poly...

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for you...

Q: Explain the purpose of using powdered ammonium sulfate in the isolation of ovalbumin from egg whites...

A: Salting Out is a method of protein purification which utilizes the decreased solubility of a certain...

Q: How important and useful to the cell is the ability of the DNA to assume various forms? Why are thes...

A: DNA is the basic hereditary molecule that is responsible for passing on genetic information from one...

Q: Which of the following G protein subunits activate K+ channels in response to the GPCR for acetylcho...

A: The G protein subunits that activates K+ channels in response to the GPCR for acetylcholine on heart...

Q: Assume that a TRlhybrid cross is made in which the genes' loci are autosomal, independently assortin...

A: We would expect 8 different phenotypes if a trihybrid cross is made in which the gene loci are autos...

Q: Instruction: The answer must be in minimum of 2 paragraphs and each paragraphs must have a minimum o...

A: Sex is a trait that determines an individual's reproductive function, male or female, in animals and...

Q: 1. List down 2 advantages and 2 disadvantages of wet mounts in stool examination

A: Wet mount test (in stool analysis) : In the wet mount test of stool analysis theProtozoan trophozoit...

Q: In which lobe of the cerebral cortex, the primary olfactory cortex lies ? [A] Frontal lobe [B] Tempo...

A: Option B is the correct choice.

Q: As the number of foxes increases, what happens to the number of mice? O the number of mice stays the...

A: Option B is correct

Q: d. b. a. ok. C. h. List the names of the structures (A -L) and their primary functions

A: Answer List the name of the structures (A-L) and their primary functions:

Q: Procedure A Add ul ampicillin to 50 of Take mixture analyse OD600 Top up to 50ml. to Add fresh LB bo...

A: This graph is of two groups group A and group B. group A is about ampicillin and group B is about co...

Q: How many ATP did you use? What type(s) of protein(s) were used? Explain when each type was used.

A: *NOTE: Kindly repost for other questions* Dear Student as per the guidelines we are supposed to answ...

Q: Hemophilia is caused by an x-linked recessive allele. Make a cross between a hemophilic Father and a...

A: Hemophilia is caused by an x-linked recessive allele.

Q: Tristan da Cunha is a remote inhabited island in the Atlantic Ocean. On this island, 0.5% of the pop...

A: It is a condition that affects the body to produce galactose sugar.

Q: What are the 3 phase of the routine stool examination? 2. What would be the pre-analytical phase i...

A: Human feces is known as stool.It is the waste residue of indigestible materials of an animal's diges...

Q: Give meanings for the following combining forms: 1. adenoid/o 6. nas/o 2. alveol/o 7. or/o 3. bronch...

A: NOTE: Since you have posted multiple questions So we will be solving the first 3 parts for you. As p...

Q: B. Co Examples Description Composition Biomolecule 364W Carbohydrates ow Lipids oot bano bns Protein...

Q: laboratory

A: For testing a place equipped for experimental study in a science. Analysis a research laboratory bro...

Q: explain how different detergents take out proteins selectively out of membrane.

A: * Detergents are molecules that form hydrophobic-hydrophilic interactions among molecules . *deterg...

Q: How Eukaryotic Gene Expression Is Influenced ?

A: Introduction The expression of genes is highly regulated in both prokaryotes as well as in Eukaryote...

Q: When preparing to place a thoracic epidural, you palpate the inferior border of the scapula. This la...

A: The answer is T7- T8

Q: Question 1: Which of the following processes is not involved in genetic engineering? A. DNA polymer...

A: The recombinant DNA technology involved transferring the desire DNA into a specific host cells in wi...

Q: of biodiversity loss and their effect on terrestrial, freshwater, and marine ecosystems and suggest ...

A: A geographic area where plants, animals, and other organisms, as well as weather and landscape, work...

Q: A 23-year-old man was brought to the ER barely conscious but in great discomfort after being wounded...

A: The correct option is E. Right ventricle.

Q: What processes occur in the interphase cell before the onset of mitosis? Why is it incorrect to say ...

A: Cell cycle: it is a series of sequential events through which cell growth and division occurs. It in...

Q: Na+K+ pump in maintaining the membrane potential of a cell.

A: The membrane is the potential represents that the balanced equilibrium potentials of the ions to whi...

Q: Which of these is a tetrapod that is NOT an amniote? A. Ostrich B. Shark C. Rattlesnake D. Salamande...

A: Answer D. Salamander

Q: åre some shapes cells can have that will have a larger surface area than a sphere? To help you answe...

A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...

Q: ranscription takes place in

Q: An action potential is considered an "all or nothing" event. What does this mean? Explain using the ...

A: Nerve impulse, also called action potential, is the change in the membrane potential due to an exte...

Q: Why is specific base pairing essential to the processes of transcription and translation? - How many...

A: The DNA is composed of sugar and phosphate that serves as the backbone, and at each sugar, a nitroge...

Q: What are NUCLEUS ?

A: Introduction A cell is the basic unit of life. All organisms are single cellular or multicellular, ...

Q: What is the main idea of the passage? A study shows that African wild dogs catch about sixteen perce...

A: The main idea of the passage should include the following notions: - Earlier thought was that Afric...

Q: Summarize the water issue concerning the Catawba River

A: *Catawba River basin is present in the North Carolina. *This lake is located in 3,305 square miles...

Q: Which of the following characteristics of a water-insoluble substance is most important in governing...

A: Cell membrane It is also referred as the plasma membrane. It separates the cell's interior environm...

Q: How did the work of each of the following scientists—Garrod, Beadle and Tatum, and Pauling— contribu...

A: Gene can be described as the unit of heredity that comprises the information related to the generati...

Q: What is a continuum of strategies (in ecology)?

A: The continuum of life-history refers to the growth, reproduction and death of organisms in a given b...

Q: How and why are avian and human muscles different?

A: Muscles are the the stretchy fiberes made up of soft tissue.

Q: 15. Which of the following is true? 16. Which of the following is true? a) Protein is made up of bot...

A: When multiple questions are posted we are allowed to answer the first three question. Kindly repost ...

Q: How is it possible to generate so many products from a DNA that is able to fit inside the nucleus of...

A: DNA is the chemical name for the organic chemical that carries genetic information and contains inst...

Q: Genes A and B are 6 map units apart, and A and C are 4 map units apart. Which gene is in the middle ...

A: Centimorgan is also known as a map unit is a unit for measuring genetic linkage. It shows the distan...

Concept explainers

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.

Question

answer the other rows please

1. This is the DNA sequence in the leading strand template. Follow the instructions given on page 77 of
module 3.
G C
C G
5
TG
G
т
3'
в
3'
A
A
A
A
A
5'
AT
ABCD

1. You are provided with the DNA sequence in the leading strand
template. See item number 1 in worksheet, row A.
information asked for in the succeeding rows:
Supply the
row B: supply the bases in the complementary strand.
row C: Assuming that the sequence in the row A is the template for
transcription, supply the bases of the mRNA transcript. Label the 5'
and 3' ends.
row D: Identify the amino acids that comprise the polypeptide chain as
the ribosome would have identified them. Just merge cells before you
label the amino acids based on the codes. Label the 5' and 3' ends.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Basics

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
RNA polymerase transcribes the following DNA template strand: 5' ACC TTT CCG 3' What is the RNA sequence going to be?
1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.
2. List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this 3’-GTCGTATAGTGA-5’, give reason if it not correct
1. Here is a DNA sequence . Give the complimentary bases. ATT CGG TCG CGC TTA ACG
6.d. Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation:
Consider the following segment of DNA:5′ GCTTCCCAA 3′3′ CGAAGGGTT 5′Assume that the top strand is the template strand usedby RNA polymerase.a. Draw the RNA transcribed.b. Label its 5′ and 3′ ends.c. Draw the corresponding amino acid chain.d. Label its amino and carboxyl ends.Repeat parts a through d, assuming the bottom strand tobe the template strand.
#1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C. nitrogen bases D. new copied strand of DNA