5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
Q: Biology Unit 5 Review - Nucleic Acids and Protein Synthesis Answer the following questions about…
A: Nucleic acids function as the genetic material in living organisms. DNA is a double helical molecule…
Q: With relevant examples where possible, illustrate the classifications of infectious diseases
A: An infectious disease is defined as: "A process that harms a person's health and is brought on by an…
Q: On 17 August 2022, the Ministry of Health of the Democratic Republic of Congo (DRC) reported a…
A: It is well recognized that the Ebola virus (EBOV), a public health emergency of worldwide concern,…
Q: The following type of tissue is composed of a single layer of cells that looks like many: a. Simple…
A: Columnar epitheliums are of two types based on the presence of cilia. Ciliated columnar cells…
Q: The Venus flytrap is a carnivorous plant that eats insects. Suppose the county where these are…
A: Loss of habitat is one of the key reasons behind the population declination of many species. This…
Q: cterium-mediated plant transformation is a method used to create transgenic plants cterium…
A: Agrobacterium tumeifaciens is a bacteria that invades some plants at the site of wound. They…
Q: In muscle, glycogen phosphorylase is stimulated (activated) by a. Glucose b. AMP c.…
A: Please follow step 2 for detailed explanation.
Q: From the DNA sequence data for the eight species (A through H) shown below, what is the genetic…
A: The DNA is the genetic material in living organisms that shows specific sequence of nucleotides. The…
Q: 3. Explain how exercise affected: a) level of activity, b) rate of cell respiration, and c)…
A: The overall health is improved via exercise, which gives people more energy throughout the day. But…
Q: What is geneticization and is it a cause for concern
A: Introduction Genetics is the scientific study of genes & heredity, It is mostly concerned…
Q: What would be the fastest possible HR if the absolute refractory period for the cardiac myocytes was…
A: Introduction: Heart rate(HR) is a speed in which heart beats in every minute. It along with stroke…
Q: 1. Which of the following is true of a maternal effect? A) The gene is located in the nucleus. B) It…
A: Maternal effect produces when specific phenotypes of offspring are controlled by the factors that…
Q: Who developed yeast knockout technique in the 1980s?
A: Introduction A gene knockout is a genetic procedure that renders one of an organism's genes…
Q: As helicase unwinds the DNA molecule, the separated strands are kept apart by Topoisomerase True…
A: DNA: Deoxyribonucleic acid (DNA) is a polymer made of two polynucleotide chains that form a double…
Q: Your supervisor, Dr. Bane, requests you to express a protein from rubber tree (Hevea brasiliensis).…
A: Numerous opportunities for the generation and isolation of heterologous proteins for research…
Q: When Griffith injected mice with IIR strain mixed with heat-killed IIIS bacteria, A. The mice…
A: Griffith did his experiment in 1928. He did his experiment by taking mice and Salmonella bacteria.
Q: Why
A:
Q: Myasthenia Gravis: flaccid paralysis Explain the physiologic basis of flaccid paralysis in…
A: Myasthenia gravis a chronic autoimmune disease in which weakness of the skeletal muscles of the body…
Q: b. This cross yields the progeny of the following phenotypes. Write the genotype of each progeny…
A: The shuffling of genes (alleles) between chromosomes is referred to as recombination. This allows…
Q: How is GMO negatively impacting the companies that are making GMO?
A: A genetically modified organism (GMO) is any organism whose genetic material has been altered using…
Q: According to the framework proposed by Blackburn et al. (2011), the term "invasive" applies to a…
A: Invasion biologists focused on various taxa and environments have adopted different model frameworks…
Q: Problem: A bacteria can multiply at an alarming rate when bacterium splits into two new cells, then…
A: Introduction Bacterial growth occurs when a bacterium divides into two daughter cells, a process…
Q: Explain your results when observations as stated below were obtained after the plasmids were…
A: DNA is a polymer composed of two polynucleotide chains that coil around each other to form a double…
Q: Why can't insulin be given per os? Please explain
A: Insulin cannot be taken by mouth because it is digestible. Oral insulin would be digestible by the…
Q: Does Totoaba offer any ecosystem benefits? I know their demise is causing the Vaquita to go extinct…
A: Totoaba: Totoaba is a large marine fish found in the Gulf of California, is well known for its high…
Q: How would scientists describe the density of a population? O 47 giraffes living on the African…
A: Population density can be defined as the average number of individuals that belong to a population…
Q: "Gametes produced form the F1 generation offspring having genotype a+ b+ / a b = 40 % a+ b+, 40 % a…
A: F1 generation cross between a+b+/a+b+ and ab/ab Allele ab ab a+b+ a+b+ /ab a+b+ /ab a+b+…
Q: On the diagram of the interneuron, drag and drop the terms dendrites, cell body, axon and synaptic…
A: The diagram in the question shows a nerve cell or neuron. The labeling will be as follows. The top…
Q: what ways to modify food and kcal intakes to achieve beneficial physiological changes
A: Beneficial physiological changes : Physiological changes in day-to-day life and activities that can…
Q: Methylated histone tail amino acids are associated with chromatin that is open only. closed only.…
A: The DNA is the genetic material in living organisms that remain associated with histone proteins in…
Q: In about 300 million Americans, 30,000 have cystic fibrosis, how many are carriers?
A: According to the Hardy-Weinberg equilibrium allele and genotype frequencies will remain same…
Q: a. Briefly describe the pharmacokinetics of inhaled nicotine. Would you expect pharmacokinetics of…
A: Nicotine is a naturally produced alkaloid in the nightshade family of the plants . It is widely used…
Q: Explain and give examples of the major functions of the liver.
A: Introduction The liver is the body's second-largest organ. It contains four lobes and can…
Q: 1. Consider a cell with surface area 2.5 x 102 mm², initial water potential of -0.3MPa and membrane…
A: When the temperature and the pressure are held constant then the potential energy of the water to…
Q: 2. *REQUIRED 1 A somatic cell in an organism develops a DNA mutation. This mutation is a beneficial…
A: The genetic traits are those which are transferred from parents to their offspring. Heritable traits…
Q: Match each statement with the best possible single answer from the list below. Terms may be used in…
A: Addition of TTGGGG repeats Correct match for this statement are - Telomerase. Explanation…
Q: Each individual gene and associated chromosomal location is plotted on a graph by themselves. Why…
A: The genes are the sequence of nucleotides present on the chromosomes. Each gene is present at a…
Q: Which statement best describes the reason maternal recessive CYP1A1 polymorphisms of CYP1A1 decrease…
A: Answer: ...It increases the metabolism of nicotine. ...It increases the metabolism of PAHs.
Q: To be considered invasive, a species would likely have population growth rates (r) in the introduced…
A: Population growth rate : Population growth rate is the rate of change in the population, in a given…
Q: A shuttle vector is a vector constructed so that it can propagate in two different host speci One of…
A: Shuttle vectors are mostly plasmid vectors that are compatible with two host cells thereby allowing…
Q: Pineal body Arbor vitae lateral ventricle cerebellum 3rd ventricle corpus callosum optic chiasma…
A: It is critical to learn and know the anatomy and physiology of the body. Many changes in the animal…
Q: Briefly summarize the article below
A: Specificity protein 7 is required for proliferation and differentiation of ameloblasts and…
Q: Describe vocational issues for individuals with sickle cell anemia? How do bacteria and viruses…
A: 1- Anemia: Sickel cell break apart easily and die . RBC live usually for 120 days but sickel cell…
Q: Explain in detail how are errors occurring during DNA replication corrected
A: In cell biology, DNA replication is a synthesis of making new double strands of DNA. The process is…
Q: When designing a study to examine the potential association between a plant based diet and heart…
A: Non-experimental or observational study designs include cohort designs. In a cohort study, the…
Q: What is apoptosis? Explain cell signaling pathways that triggers it.
A: Introduction : A multicellular organism's life cycle includes a crucial process called cell death.…
Q: The schematic on the right is for which molecular biology method? What information…
A: Please follow steps 2 & 3 for detailed explanation.
Q: QUESTION 45 Which of the following statements is FALSE? Low oxygen levels in the blood increase…
A: Introduction: The body's cells require energy for metabolism, that is supplied by the blood from the…
Q: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined…
A: Note: As per guidelines we can answer one question at a time ask rest questions to get answers.…
Q: Briefly discuss the following topics and include appropriate examples for each: 1.1. Information…
A: All of the branches of the natural sciences that focus on different facets of life's processes are…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile – Tyr – Lys – Asp mRNA sequence (5’-3’)AUG – AAC – UGU – UUU – GAA – AUG – CUU – CGU – AUU – GAU – GAA – GGU – CUU – CGU – CUU – AAA – AUU – UAU – AAA – GAU - Write the dsDNA that encodes for this peptideThe following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?
- A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A:This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B:This will not affect the phenotype because only the second amino acid is different from the original protein. C:This will not affect the phenotype because the protein will be identical to the original protein. D:This will affect the phenotvpe because all of the amino acids after the first one will be different from he original protein.DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids? 3. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCT CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What type of mutation has occurred in the sequence? How does it affect the expression of amino acids? 4. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCG CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What of mutation mutation has occurred in the sequence? How…The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGCTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out)Normal DNA: TGC GTG CTT AAG CGG TGT ACA CGT TGC mRNA: Animo Acid: 1st Mutation TGC GTG CTT AAG CGA TGT ACA CGT TGC mRNA: Animo Acid: Do you think it will affect the protein’s function? Why? 2nd Mutation TGC GTG CTT AAG CGG TGT GCA CGT TGC mRNA: Animo Acid: What kind of mutation is this? Do you think it will affect the protein’s function? Why?
- A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A mutation in this gene removes the first G in the strand.What is true of this mutation's effect on the phenotype?1.It will affect the phenotype because although most of the protein will be identical, the first amino acid will be different.2.It will not affect the phenotype because the protein will be identical to the original protein.3.It will affect the phenotype because all the amino acids past this point will be different from the original protein.4.It will not affect the phenotype because only the first amino acid is different from the original protein.Identify the dinucleotide CA repeat region and the score in the following sequence:TGGCACACTCACACCACACAGACAGTTAFor the following sequence design the forward and reverse primer... explain and justify your answer. Gene of Interest: a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…