Q: Convert to cDNA and add linkers
A: This is the High-throughput sequencing that has become the revolutionary technique for the…
Q: What is the target of NK cells? What is the target of phagocytes? What is the target of Cytotoxic T…
A: Introduction :- By preventing the progression of cancers and microbial infections and the resulting…
Q: 18. The amino acid sequence is matched with three bases on mRNA codon or DNA codon (pick one). 19.…
A: Please follow step 2 for detailed explanation.
Q: 4. Normal yeast cells can survive on a diet of sugars, a few simple salts and one vitamin. They can…
A: Alleles are the two forms of a gene. Allele control the same trait though differently. For example,…
Q: The Venus flytrap is a carnivorous plant that eats insects. Suppose the county where these are…
A: Loss of habitat is one of the key reasons behind the population declination of many species. This…
Q: What is apoptosis? Explain cell signaling pathways that triggers it.
A: Introduction : A multicellular organism's life cycle includes a crucial process called cell death.…
Q: 25) In most social insects, females (workers and queens) develop from fertilized eggs and are…
A: The conflict of interest between the queen and her worker daughters over the generation of…
Q: Pituitary secretion of adrenocorticotropic hormone (ACTH) is inhibited by elevated levels of: Group…
A: Adrenocorticotropic hormone is also called as ACTH is the harmone released by the pituitary gland.…
Q: pZERO®-1 is a 2808 bp cloning vector from Invitrogen. This vector allows effective selection of…
A: The PET sequences are simentensously traced to the genome assembly to define the boundaries of…
Q: Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading…
A: DNA structure formation
Q: Use the following information to answer the next question. The Canada lynx has a diploid number of…
A: Chromosome is an elongated thread like structure which is present inside the nucleus of the cell. It…
Q: A B Figure 1 The postgraduate student, Vanessa, cloned her gene of interest into two different…
A: A vector is a living organism that can transmits an infectious agent from an infected animal to…
Q: DNAT A C C A C C C C C G T A T G G C T G G G…
A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…
Q: Control of blood flow is primarily mediated by
A: Arterioles, small blood vessels that carry blood away from your heart. They control blood flow…
Q: On the diagram below, i) draw where the uncoupling protein must be located and ii) indicate the…
A: Electron transport chain: A series of protein complexes that are generally found in the outer wall…
Q: Many invasion process models (including the framework in Blackburn et al. 2011) have emphasized that…
A: Invasion : Biological invasion is a process by which an organism introduced to and establishes a…
Q: A polyhistidine-tag or better known by its trademarked name His-tag is an amino acid motif present…
A: In vectors used to produce recombinant proteins, the DNA sequence defining a string of six to nine…
Q: Differentiate Invitrogen pCR® II-TOPO® Vector from pBR322 Vector.
A: Molecular cloning : Production of genetically identical copies of a cell or its genetic material is…
Q: Species A has 2 amino acids. minimum codon length: Species B has 7 amino acids. minimum codon…
A: Introduction :- The biggest group of organisms in which any two individuals of the right sexes or…
Q: Besides plants, animals could also be genetically engineered. Describe TWO (2) transgenic fishes…
A: Transgenic animals are animals that carry a foreign gene. These genes are deliberately introduced…
Q: A shuttle vector is a vector constructed so that it can propagate in two different host speci One of…
A: Shuttle vectors are mostly plasmid vectors that are compatible with two host cells thereby allowing…
Q: The taxon Crocodilia includes crocodiles, Aves includes birds, and Squamata includes snakes and…
A: Monophyletic is a group of organisms which are classified in same taxon and will share the most…
Q: what is natural sciences? what is the value of studying natural sciences and how useful it is to us…
A: Biology is one of the sub disciplines of natural science. Natural science comprises of both life…
Q: During the colony selection at the end of the cloning step, there is a possibility of encountering…
A: During colony screening, false colonies in the plates hinder the selection process, which is…
Q: Explain the roles of cell signaling in DNA transcription and protein synthesis.
A: Introduction Cell signalling is the mechanism through which cells react to information. Cell…
Q: Oldfield mice that live on beaches of the gulf and Atlantic coast of Florida tend to white, wherease…
A: The oldfield mouse or the beach mouse is a nocturnal species of rodent in the family Cricetidae.…
Q: The rapidly growing Japanese knotweed plant has a wide range of growth in North America. This plant…
A: Japanese knotweed Scientifically known as Reynoutria japonica, also known as Fallopia japonica and…
Q: Explain how this is related to increased breathing rate and depth (taking more and deeper breaths)…
A: We can breathe due to our respiratory system and lungs. They release carbon dioxide and inspire…
Q: ATP hydrolysis is exergonic or endergonic
A: Please follow step 2 for detailed explanation.
Q: Explain in detail how are errors occurring during DNA replication corrected
A: In cell biology, DNA replication is a synthesis of making new double strands of DNA. The process is…
Q: 7.13 In rabbits, the dominant allele C is required for colored fur; the recessive allele c makes the…
A: Introduction :- The relationship between two genetic variants is referred to as dominant. Each gene…
Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…
A: Removing RNA is one of the crucial processes in plasmid purification, especially after the manual…
Q: Which of the following components found in the bone matrix make bone hard? calcium…
A: The skeletal system gives stability to the body. It is responsible for locomotion of the organisms.
Q: Besides using A. tumefaciencs in the generation of transgenic plants, elaborate on the THREE (3)…
A: Agrobacterium tumefaciens, a gram negative bacteria that is used to perform horizontal gene transfer…
Q: Which of the following substances is unlikely to diffuse across the lipid bilayer of a typical cell…
A: The cell membrane is also known as the plasma membrane. It is made up of two phospholipid layers.…
Q: Kary Mullis invented the Polymerase Chain Reaction (PCR) technique in 1983 which won him the 1993…
A: Polymerase Chain Reaction: A very small DNA sample can be amplified (or part of it amplified) to a…
Q: 1. Consider a cell with surface area 2.5 x 102 mm², initial water potential of -0.3MPa and membrane…
A: When the temperature and the pressure are held constant then the potential energy of the water to…
Q: 32. What are the two components of tRNA which are important for building a protein? what are…
A: The tRNA is responsible for transferring amino acids to the ribosome at the site of translation.…
Q: The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33%…
A: Introduction Genetic material is the portion of a cell that contains the genetic information that…
Q: Living modified organism (LMO) is defined as any living organism that possesses a novel combination…
A: Living modified organism means an organism which genetic materials has been altered artificially…
Q: heightened responses to ethanol, and ken&barbie (kb) lack external genitalia. [These are real genes…
A: The technique of pinpointing a gene's position on a chromosome is known as gene mapping. The most…
Q: In Semi conservative replication: A. After one round of replication of a single molecule of DNA, one…
A: Answer b) After one round of replication of a single molecule of DNA, two resulting DNA molecules…
Q: Genetically modified foods are products produced from organisms that have had genetic modifications…
A: Biological entities (plants, animals, or microorganisms) in which their genetic material (DNA)…
Q: Name the molecules that cycle thriught living systems
A: Living organisms continuously interact among themselves and also with their environment in order to…
Q: Create a graph as a better way to display the data in the table 2) Determine which mutations (5q,…
A: Tumorigenesis or oncogenesis refers to the initial formation of cancer, where normal cells is prone…
Q: You like a wide variety of types of lettuce, so you plant many different varieties in your garden.…
A: The diversity refers to the different kind of variety of organisms present in an area. A wide…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
Q: In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that…
A: Note: As per the guidelines, the first question has been solved here. Please post the other…
Q: 47. Expansion of the extracellular fluid volume leads to an increase in the plasma concentration of…
A: Whenever the extracellular volume is decreased, Anti Diuretic Hormone, aldosterone, and angiotensin…
Q: 2. Why did the reindeer grow at this rate?
A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…
The schematic on the right is for which molecular biology method?
What information does this method reveal?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- HBs Antibody Principle: This test uses the “sandwich principle”, a slide phase colloidal gold enhanced immunoassay technique for determination of HBs antibody in human serum or plasma. The nitrocellulose membrane was immobilized with HBs antigen on the test band region and anti-HBsAg antibody on the control band region. During the assay, the specimen is allowed to react with the colored conjugate (HBs Ag colloid gold conjugate); the mixture then migrates chromatographically on the membrane by the capillary action. For a positive result, a color band with the specific antibody-HBsAg complex will form on the membrane. Absence of this colored band in the test band region suggests a negative result. To serve as a procedural control, a colored band at control region always appears in the test area. The reagent contains scavenge antibodies to reduce nonspecific reactivity in human serum or plasma specimens. The sensitivity of the test is 10mIU. HBs Antigen Principle:…In your own words, explain why this procedure is referred to as an enzyme-linked immunosorbent assay.For an Immunoprecipitation experiment:The cellular extract contains a protein labeled with a fluorescent dye, which emits green fluorescence under UV light. Explain your observations in IP-1, IP-2, and IP-3 tubes by considering the interaction among antibody 1 (or antibody 3), the fluorescent-labeled protein, and the protein-A agarose beads.
- What is T DNA tag?Human Immunodeficiency Virus (HIV) Principle: The assay starts with a sample applied to the sample well. A recombinant HIV antigen conjugated to colloidal gold embedded in the sample pad reacts with the HIV antibody present in serum or plasma forming conjugate / HIV antibody complex. As the mixture is allowed to migrate along the test strip, the conjugate / HIV antibody complex is captured by recombinant HIV antigen immobilized on a membrane forming a colored test band in the test region. A negative sample does not produce a test band due to the absence of colloidal gold conjugate / HIV antibody complex. The antigens used in the conjugate test are recombinant proteins that correspond to highly immunoreactive regions of HIV 1 and HIV 2. A colored control band in the control region appears at the end of test procedure regardless of test result. This control band is the result of colloidal gold conjugate binding to the anti-HIV antibody immobilized on the membrane. The…fill in DNA antisensestrand for this
- Hello, can you help and explain to me what the difference between agglutination and coagulation? And where does the DNA replication bubble occur (is it in the blue strand)? What does Bubble work?The substrate for the secondary antibody used in the lab for western blotting is: triton X-100 BCIP/NBT Tween TMBTrue or False: In a Western blot or an ELISA, you are looking for visible clumps
- Southern blotting technique is used ina) Monoclonal antibody productionb) In vitro culturec) Genetic finger printingd) Polymerase chain reactionSDSPAGE is similar to other protein detection and quantification methods such as Native PAGE, Western Blot, 2D PAGE and zymogen. Select all similarities between SDSPAGE and the only the bolded method in the previous sentence. Denatures proteins Detects specific protein from mixtures based on antibody binding Detection of protein requires enzyme degredation Separation of protein occurs twice Requires separation of proteinWith regard to the experiment described in Figure shown, Explain why an antibody was used to remove the bacteria thatwere not transformed. What would the results look like, in allfive cases, if the antibody/centrifugation step had not beenincluded in the experimental procedure?