Q: Identify the type of mutation that occurred to produce the abnormal hemoglobin. Explain why you…
A: Nonsense mutation: This is a condition in which a protein loses its function, resulting in sickness…
Q: Below is a sequence of DNA.…
A: Introduction :- Adenine (A), thymine (T), cytosine (C), and guanine (G) are four nucleic acid bases…
Q: Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the…
A: Quality transformations include adjustment in the construction of qualities which changes or alters…
Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr
A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…
Q: Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…
Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part…
Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…
A: Central dogma is the process where in the information stored in nucleic acids is transferred to…
Q: Convert the following sequence into protein strand using one letter code:…
A: The protein is made by the post-translational modification of peptide chains, and these peptides are…
Q: Below is a sequence of DNA.…
A: The process of identifying the coding region and the position of a gene in a genome is known as gene…
Q: Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. 1…
A: Primers: Short nucleotide sequences usually 6-10 bp in size that acts as the initiation point for…
Q: The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide…
A: mRNA consist of mononucleotide sequence that specifies amino acids sequence in peptide chain. One…
Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…
A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…
Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence
A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…
Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…
A: When DNA is converted into RNA then this is called transcription. When mRNA encodes protein then…
Q: Obtain the self-dotplot of the following sequence to identify repeat region:…
A: There are various alignment tools available at EMBOSS. It is studied under the domain of…
Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…
A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…
Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…
A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…
Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…
A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…
A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…
Q: Shown here is a DNA sequence. Which strand is the template?…
A: There are two types of strands in transcription process of the eukaryotic DNA Template strand…
Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. If…
A: Transcription can be defined as the process in which RNA is formed from the DNA. It is the initial…
Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG
A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…
Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA
A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…
Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…
Q: Using the genetic code, interpret the following set of nucleotides.…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: How many PAM sequences are present in the sequence below?…
A: Protospacer adjacent motif(PAM) sequence It is a short DNA sequence(usually 2-6 base pairs in…
Q: Will the pairs of sequence might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′…
A: Insertion is the expansion of at least one nucleotide base sets into a DNA (deoxyribonucleic…
Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…
A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…
Q: Write the codons for the following amino acids. 1. Phe 2. Val
A: Genetic codon: - It is the 3 nucleotide sequence of DNA and RNA, all bases are involved in formation…
Q: Will the pairs of sequence might be found at the ends of an insertion sequence? a. 5′–AAACCCTTT–3′…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…
Q: A partial amino acid sequence from the tick anti-coagulant protein is:…
A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…
Q: Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the…
A: Gene mutations involve alteration in the structure of genes which alters or modifies the structure…
Q: What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?
A: The sequence of a protein is notated as a string of letters, according to the order of the amino…
Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…
A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…
Q: Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was…
A: Pyrosequencing is a form of sequencing that works by the principle of DNA replication. The template…
Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…
A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…
Q: Transcribe the following DNA sequence into RNA, and then into amino acids…
A: Transcription is the process by which the information stored is transcribed into mRNA. And…
Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC
A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…
Q: Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
A: DNA => Transcription => mRNA => Translation => Protein Given a sequence of DNA:…
Q: Using the genetic code below, decipher the following mRNA sequence.…
A:
Q: Translate the following DNA to RNA and from RNA to amino acid sequence using the help of Codon…
A: The process of conversion of DNA into an mRNA is called transcription. mRNA acts as a template for…
Q: Based on the sequence data below. Which of the indicated sections of the sequence can you trust to…
A: DNA (Deoxyribonucleic acid) sequencing is an essential component of molecular biological studies.…
Q: Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence:…
A: So the given m-RNA code for - met-glu-ser-leu-leu.
Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…
A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…
Q: Determine the sequence of amino acids specified by the codons in the following information strand.…
A:
Q: Define simple sequence repeats (SSRs)
A: The microsatellites that stretch DNA is known as Simple Sequence Repeats (SSRs). They are also…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: What is the meaning of the statement “The code is redundant but not ambiguous?”.
A: Base-pair substitution, deletion, or addition constitutes a mutation in a gene. The effect of such…
Identify the dinucleotide CA repeat region and the score in the following sequence:
TGGCACACTCACACCACACAGACAGTTA
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Obtain the self-dotplot of the following sequence to identify repeat region: TGGCACACTCACACCACACAGACAGTTAUsing the genetic code, interpret the following set of nucleotides. AUGGGUCCAUGGCGUAGGCCAAAUGAUGAGGAAUGAFor the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCC
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
- What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?For the following sequence design the forward and reverse primer... explain and justify your answer. Full sequence would be: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg…For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'
- For the following sequence design the forward and reverse primer... explain and justify your answer. Gene of Interest: a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5′—UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU—3′Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.