(6) Which of the following descriptions regarding human genetic variations is correct? A) Unlike rare variants, common variants have a frequency >5% and usually indicate low penetrance risk loci. B) Copy number variations frequently lead to decrease in gene expression. C) Both linkage analysis and association studies identify causal risk genetic variants. D) SNP is a common form of structural variation.

(6) Which of the following descriptions regarding human genetic variations is correct? A) Unlike rare variants, common variants have a frequency >5% and usually indicate low penetrance risk loci. B) Copy number variations frequently lead to decrease in gene expression. C) Both linkage analysis and association studies identify causal risk genetic variants. D) SNP is a common form of structural variation.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 11QP: When the human genome sequence was finally completed, scientists were surprised to discover that the...

See similar textbooks

Similar questions

What is the central dogma of biology? Describe the molecular processes that accomplish the flow of genetic information as listed by the central dogma?
How many SNPs are in the human genome?
Explain the concept of inherited molecular disease ?
I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?
What is the purpose of the Human Genome Project? Why do researchers want to know the details of the human genome?
What is the significance of mapping the human genome?
Discuss the sequencing technology used to resolve the human genome in 2005, its significant advantages and limitations?
What exactly is a genome?
Increasingly, whole-genome sequencing of individuals is being done to help identify and treat medical conditions. Genome sequencing invariably identifies a number of variations, some common and some rare, that might be clinically relevant. For example, suppose a person had their genome sequenced to help determine their risk for cardiovascular disease and, just by chance, the sequence revealed that they carry one or more variants that predispose them to cancer or Alzheimer disease. Does the sequencing laboratory or physician have an obligation to report this finding, which was not the purpose of the sequencing and which the patient did not request? What about reporting variants for which no or limited information can be provided about their clinical significance? Does the answer to this question differ for sequencing done on children?
Which organism violates the central dogma of molecular biology?
What is the most surprising result found thus far in the human genome studies?
The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globin