6. Sequencing of the heterochromatic regions of the Drosophila genome indicates that within 20.7 Mb, there are 297 protein-coding genes. Given that the euchromatic regions of the genome contain 13,379 protein-coding genes in 116.8 Mb, what general conclusion about gene density is apparent?

6. Sequencing of the heterochromatic regions of the Drosophila genome indicates that within 20.7 Mb, there are 297 protein-coding genes. Given that the euchromatic regions of the genome contain 13,379 protein-coding genes in 116.8 Mb, what general conclusion about gene density is apparent?

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter13: Observing Patterns In Inherited Traits

Section: Chapter Questions

Problem 3SQ

See similar textbooks

Related questions

Q: Many people of Asian ancestry have alcohol dehydrogenase enzymes that are far more efficient than…

A: We know that Alcohol (Ethanol) gets converted into acetaldehyde with the help of enzyme alcohol…

Q: Which pattern of inheritance is associated with a trait that in about one-fourth of the children,…

A: The question claims that both males and female children acquire the feature. As a result, the sex…

Q: 11 del 154 Chapter 13 smo ad plo odtone gibier Telow and ? QUESTION Kaylee Kauff EXERCISE #3 "Genes…

A: Gene regulation is defined as the process used to control the location, timing and the amount in…

Q: Intracellular signaling pathways provide multiple opportunities for the amplification of a response…

A: there are several intracellular signaling pathways works together in a body that regulates normal…

Q: Which of the following virulence factors enable(s) bacteria to avoid phagocytosis by white blood…

Q: 1 Sarah, a trainee of the electron microscopist at the local hospital, is reviewing some…

A: mitochondria is an essential organelle of cell that general energy by phosphorylation in form of…

Q: A mutant haploid strain of Saccharomyces cerevisiae (yeast) called cox2-1 was found that was unable…

A: S. cerevisiae is utilized as a prototype in biological sciences to examine conserved processes…

Q: xplain the data below and why knockout of Angpt2, MMP3 and MMP10 appears to inhibit metstastasis.

A: MMP stands for matrix metalloproteinase is a multi-functional factor that plays a crucial role in…

Q: Which of the following cell-types are most likely to secrete Matrix Metalloproteases (MMPs) that…

A: Matrix metalloproteinases, also known as matrix metallopeptidases or matrixins, are…

Q: Could you help fill in tables UV-13 to find the allele and genotype frequencies using the Hardy-…

A: As different expressions of the same gene, multiple alleles affect the same trait. The wild-type…

Q: Fishy proteins Cod fish have two alleles for a protein that binds oxygen, called the Hb-1 and Hb-2…

A: Understanding life and its diversity has been centered on how natural selection has shaped the…

Q: Clone number in this case is number 196 as shown in the images. What is the exact length of the…

A: The DNA is the deoxyribonucleic acid which can be analysed in molecular biology lab by running the…

Q: You clone a fragment of DNA into the middle of the lacZ sequence of a plasmid, introduce the plasmid…

A: The insertion of a gene into a foreign gene is known as gene cloning or genetic engineering.…

Q: In wild sunflowers, populations occur that are either yellow flowers (wild type) or white flowers.…

A: A trait is a characteristic feature that is unique to specific individual. Each trait is represented…

Q: if the water potential of a dialysis is -4.0 and pressure potential was -2.0 and the solute is…

A: Introduction : The term "water potential" refers to the kinetic energy of water. When a solute is…

Q: Starting as a lipid in some holiday prime rib, trace the path that energy and biomass make as that…

A: Triglyceride molecules are the most common form of fatty acid storage and transit within cells and…

Q: Q9. Here is a hypothetical evolutionary tree showing domestic and wild pigeon populations. If this…

A: Introduction Phylogenetic tree is also known as dendrogram. It is a diagram that shows the…

Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…

A: True breed plants are defined as having identical alleles, which constitute their genotype and give…

Q: Your classmate's eyes are red and watery. Give three possible explanations.

A: Red eye is described as irritated, re and bloodshot eyes.This will happen when the blood vessel…

Q: The following picture drawing represents co-translation in E. coli. Answer the questions below the…

A: The question is to analyse the picture and answer the questions accordingly. Let's move on to the…

Q: If the multicellular organisms arise from the unicellular organisms, can you tell that all the…

A: A chronological succession of communities, animals, cells, or genes connected in a straight line…

Q: How many different DNA sequences could code for amino acid sequence Met-His-Leu-Thr-Trp-Lys? (Note:…

A: DNA is a hereditary molecule. It carries the genetic information that is passed from one generation…

Q: How many moles of air are there in a 2.0 L bottle at 19°C and 747 mm Hg? • PV=nRT • R = 0.0821 (L…

A: Given that P = 747 mm Hg V = 2 litres T= 19°C= 273.15 + 19= 292.15 K n= number of moles. Now, PV=nRT…

Q: What is the Shannon diversity index value for this community? What is the Species evenness…

A: Shannon diversity index (H) is given by negative of the sum of pi*ln pi and the species evenness (J)…

Q: please give an evolution timeline about dogs. (7 keypoints please) Please use the format below

A: The domestic dog, also called as Canis familiaris or Canis lupus familiaris, has earned the title of…

Q: Major event of special creation theory

A: The research of how life on Earth emerged from non-living materials is known as abiotic biology,…

Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…

A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…

Q: Which of the following statements related to the Calvin Cycle is CORRECT? Six molecules of G3P are…

A: Calvin cycle is the part of photosynthetic reactions, where carbon is fixed into sugar. This…

Q: talk about the significant things that happened to darwin in his trip to falkland island, like what…

A: Charles Darwin visited the Falkland Island twice and during the time period of 1 March - 6 April…

Q: Why should it make sense that a mitochondrion(a cellular organelle) is larger than a phospholipid…

A: Mitochondria (singular: mitochondrion) is the cell organelle that involves production of energy in…

Q: Bob is urinating strange. Something is wrong with the Na+-K+ ATPase pumps on the basolateral…

A: The proximal tubule is the first and longest segment of a nephron, the functional unit of the…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: Respiratory bronchiole

A: Lungs: These are a pair of spongy and air-filled organs which are located on either side of the…

Q: a) Viruses can have DNA or RNA genes b) Antibiotics can kill bacteria, viruses and fungi c)…

A: INTRODUCTION Answers of a to l is given below.

Q: In wild sunflowers, populations occurs that are either yellow or white. one variety of true breeding…

A: It is given that, in wild sunflowers, populations occur that are either yellow or white. one variety…

Q: Love the One You're With There are six known species of lizard that can reproduce both sexually and…

A: The organism's or an environmental group's atmosphere is the combination of physical, biological,…

Q: Pls help sorry for the trouble. Explain the mechanism that enables a local anesthetic to work and…

A: Mechanism of Action-Local anesthetics work to block nerve conduction by reducing the influx of…

Q: If you irrigate a wound with hydrogen peroxide it will bubble. What causes the bubble even if the…

A: Hydrogen Peroxide is an antiseptic that is used in the skin to prevent certain infections when there…

Q: What is the main difference between F1 and F2 distributions?

A: Traits do not skip generations (generally). If the trait is displayed in offspring, at least one…

Q: Briefly explain the functions of the four procedures you learned about in this lab: DNA…

A: DNA Extraction- DNA extraction is a technique to separate DNA from cell membranes, proteins, and…

Q: inducible operon

A: Transcription: The process of copying of a segment of DNA into RNA is known as Transcription. The…

Q: mitochondrial genes affecting tRNAs. For example, one form of MELAS (mitochondrial myopathy,…

A: Mitochondrial diseases ( MELAS) are a heterogeneous group of rare genetic disease it is caused…

Q: Discuss the diversity of gas exchange you have observed in Arthropoda?

A: Arthropoda is largest phylum of the kingdom Animalia which includes insects. Word Arthropoda is…

Q: QUESTION 3 In the pedigree below, all shaded individuals express the gene in question. For example,…

A: In the given pedigree, there are cases where it skips generation. For example, Ann and Michael do…

Q: 8. Populations of snapping shrimp from each side of the Isthmus can now be described as two separate…

A: The process of creating new species is called speciation. A species is a group of creatures that may…

Q: How will the staining appear if if the destaining step were done at high temperature?

A: Staining is a method of selectively colouring the components of a sample, such as a cell or tissue,…

Q: What is the mechanism by which the Alu sequence has become dispersed to many sites in the genome?

A: An Alu elements is a transposable elements also known as the jumping gene . The transposable…

Q: 16. In cold water, natural selection would favor heterozygotes that expressed Hb-1 and Hb-2 at the…

A: The sequence of nucleotides in DNA leads to gene. It encodes a particular peptide. There are two…

Q: A male has a particular X-linked recessive genetic disorder. His partner is normal, but her father…

A: Introduction Our biological parents pass on certain genetic traits to us. The term "X-linked…

Q: When using the plasmid shown below for cloning, which restriction enzyme site(s) (all indicated with…

A: The restriction enzyme is the specific enzyme that cut the DNA internally at a specific recognition…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Madison Lenher!
6. Sequencing of the heterochromatic regions of the Drosophila genome indicates that within 20.7 Mb, there are 297
protein-coding genes. Given that the euchromatic regions of the genome contain 13,379 protein-coding genes in 116.8
Mb, what general conclusion about gene density is apparent?
www.w

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

EVOLUTION LINK Explain some of the evolutionary implications that one can conclude from mice and humans having about five hundred DNA segments that are completely identical.
Bt toxin is considered to be. a gene for modifying insect DNA an organic insecticide produced by bacteria useful for humans to fight against insects a recombinant protein
Need help 1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of 5 nucleotides (aka, a 5-mer) a)How many possible 5-mers are there? Remember that each position in the 5-mer has one of four nucleotides. b) Pick a 5-nucleotide position at random in the genome: what’s the probability that your forward primer matches there? Focus for now just on one strand of DNA. c) Pick a random 5-nucleotide position in the genome: what’s the probability that your forward primer does NOT match there? Focus for now just on one strand of DNA. d) How many physical locations might your forward primer sit in the genome? Focus just on one strand of DNA. Ignore whether or not it matches at a given location. this is one question with different parts. I would really appreciate it if all parts are answered. and I will defiantly rate.
hello i need help with this DNA sometimes has chemicalgroups attached, called methyl groups, that affect geneexpression. Suppose that, during each hour, first a fractionm of unmethylated locations on the DNA become methylated,and then a fraction u of methylated locations become unmethylated. Find a recursion for the fraction f of theDNA molecule that is methylated.
Please answer fast 1. When a researcher states that two sequences share a conserved region, what principle isinvoked? a. the sequences are homologousb. the sequences are similarc. the sequences share the same functiond. the sequences are homogenous 2. Local sequence alignment algorithms are a better choice than global sequence alignmentfor a. finding homologous DNA elements among distantly related organismsLocal sequence alignment algorithms are a better choice than global sequence alignment b. finding homologous DNA elements among closely related organisms 3. Which of the following sequence alignment programs work by doing local alignments? a. BLASTb. Clustalc. MUSCLEd. T-Coffee 4. The difference between local and global sequence alignments is that local alignmentalgorithms attempt to a. align arbitrary-length segments of the sequencesb. align every residue in every sequence
6) If you had the ability to do gene editing with ONE gene for the betterment of human kind, which one would you choose, and why? Assume you could either change an abnormal allele associated with a disease, such as the cystin gene associated with Cystic Fibrosis to its normal wild type, or add a pre-existing human allele to a genome
Please answer fast 1. Genome annotation refers to all of the following except a. assigning a unique identifier given to a DNA or protein sequence recordb. locating genes in sequencesc. adding known functions to the sequenced. assigning the sequence to a functional categorye. All of the above are correct 2. Which of the following databases contain curated annotations about human genes? a. GENCODEb. RefSeq c. UniProtKBd. All of the above 3. Which database covers a wider range of functional definitions and therefore would bea better choice for exploring the genome for new genes? a. GENCODEb. RefSeqc. UniProtKBd. All of the above 4. AKT1 is the official ___________________ for a gene. a. gene IDb. namec. symbold. all of the above 5. Which BLAST (Basic Local Alignment Search Tool) variant would you select toconduct a translated nucleotide query? a. BLASTnb. BLASTpc. BLASTxd. TBLASTne. TBLASTx
please answer everything thank you 3. What intermolecular bond has the greatest influence on the coiling of DNA to the histone complex?A. Electrostatic interactionB. Covalent bondC. Van der Waals interactionD. Phosphodiester bond 7. What is the sequence following compounds in terms of increasing solubility to dilute methanol solution?A. Adenine → Adenosine → Adenosine monophosphateB. Adenosine monophosphate → Adenosine → AdenineC. Adenine →Adenosine monophosphate → AdenosineD. Adenosine diphosphate → adenine → Adenosine triphosphate
6. Which of the following DNA sample composition is expected to have the highest boiling point?A. 60% GC pair and 40% AT pairB. 50% GC pair and 50% AT pairC. 80% GC pair and 20% AU pairD. 20% GC pair and 80% AU pair7. What is the sequence following compounds in terms of increasing solubility to dilute methanol solution?A. Adenine → Adenosine → Adenosine monophosphateB. Adenosine monophosphate → Adenosine → AdenineC. Adenine →Adenosine monophosphate → AdenosineD. Adenosine diphosphate → adenine → Adenosine triphosphate8. Which RNA molecule is NOT involved in the processes of transcription and translation?A. Messenger RNAB. Transfer RNAC. Ribosomal RNAD. Micro-RNA 9. Which of the following functional groups promote the separation of nucleotide fragments in gel electrophoresis?A. Phosphate groupsB. Ribose moietiesC. Purine basesD. Pyrimidine bases10. How many nucleosomes are there in 6 solenoids?A. 10B. 42C. 36D. 50
6. Which of the following DNA sample composition is expected to have the highest boiling point?A. 60% GC pair and 40% AT pairB. 50% GC pair and 50% AT pairC. 80% GC pair and 20% AU pairD. 20% GC pair and 80% AU pair7. What is the sequence following compounds in terms of increasing solubility to dilute methanol solution?A. Adenine → Adenosine → Adenosine monophosphateB. Adenosine monophosphate → Adenosine → AdenineC. Adenine →Adenosine monophosphate → AdenosineD. Adenosine diphosphate → adenine → Adenosine triphosphate
2ith the diagram provided please write the polypeptide. sequence obtained from the translation of the black allele gene
Genetics of man 1)Determine the sex of the individual/patient based on your karyotyping results attached below. 2)Specify what kind of disorder this individual/patient may have based on your karyotyping results attached below .