Answered: if the water potential of a dialysis is…

if the water potential of a dialysis is -4.0 and pressure potential was -2.0 and the solute is sucrose, what was the concentraiont of the sucrose solution? the tempertaure kf the room is 37 c

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter20: Iv Medication And Titration Calculations

Section: Chapter Questions

Problem 7SST

See similar textbooks

Related questions

Q: A genetic counsellor is working with a couple who have just had a child who has a debilitating…

A: Epidermolysis bullosa or EB is a rare inherited skin disease. It is an autosomal recessive disease,…

Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…

A: Introduction:- The true breeding plant varieties means that they are homozygous ( genotypically) for…

Q: A B D C

A: A Removable Partial Denture(RPD) is basically a denture for a partially edentulous patient who have…

Q: structure of a bacterial cell

A: Bacteria: Bacteria are unicellular prokaryotic microorganisms. There are 4 common forms of bacteria…

Q: The genus Homo dates back to about____. a. 3.9 million years ago b. 1.8 million years ago c. 250,000…

A: At some point between 3.0 and 2.5 million years ago, the genus Homo first appeared . The Homo…

Q: In the practical you have been analysing a human genomic library. You know from your calculations…

A: Genomic library - A DNA library is a collection of clones of DNA designed so that there is a high…

Q: Summarize the graph. 2. My hypothesis was that the lima beans would have the most eggs on them.…

A: Please note for a more detailed discussion, the size, weight, and type of beans used are needed.…

Q: Provide a diagram of the EPH RECEPTOR B2 (EPHB2) structure. Give bioinformatics structure

A: Ephrin-B2 is a powerful regulator of endothelial cell activity, implying that ephrins influence cell…

Q: Which statement best describes the interaction that occurs as a result of the bindi ligand to a…

A: Option- B

Q: What does the antisaccade task measure? A. The ability to inhibit a movement B. The ability to vary…

A: The cerebral cortex is the uppermost part of the brain and contains the majority of the brain's grey…

Q: Based on the group it belongs to, which of these land plant innovations are possessed by Ferocactus…

A: The plants comes under kingdom plantae. Ferocactus wislizeni comes under clade angiosperm. Being…

Q: During capillary exchange, which of the following occurs only at the arterial end of a capillary?

A: Introduction Capillaries are extremely narrow (less than 1 mm long), microscopic tube with one cell…

Q: All of the following regarding ribosomes are true EXCEPT: A. Ribosomes are comprised of protein and…

A: The answer is option c. All of the following regarding ribosomes are true EXCEPT ribosomes bind…

Q: Which of the following would be considered "extreme" environmental conditions for microbes? a) pH of…

A: Introduction Extremophiles are microorganisms that grow well in extreme environments, which humans…

Q: The storage of Carbon Dioxide is part of the carbon cycle. Please formulate an explanation relating…

A: Introduction to Carbon Cycle • Carbon isotopes have been very heavily utilized to study various…

Q: for the dominant Rh trait: for the recessive Rh trait:_ visspen od tonn re the possible genotype(s)…

A: Rh factor was reported in red blood cells of Macaca rhesus ( rhesus monkey ) by landsteiner and…

Q: Below is a tulip flower. Based on your reading, click the structure or structures where pollen is…

A: A tulip is a flower with bright petals and is a herbaceous bulbiferous geophyte. It is a complete…

Q: Fill up the table: Test tube A ISO amy B ethanol C methanol D ethanol Observations Before (include…

A: Fischer esterification, an acid-catalyzed reaction between isoamyl alcohol and glacial acetic acid,…

Q: 1. What are the new DNA sequences and the corresponding new amino acid sequences of these two…

A: Any change in the DNA sequence is known as mutation. Usually two types of mutations are found that…

Q: Homo habilus can be characterized as____. a. more robust than P. boisei b. somewhat similar to Au.…

A: The Latin word homo means "man" or "human." To emphasize how closely related this species is to our…

Q: Which is a structural gene? A. The gene that encodes ß-galactoside permease OB. Allolactose OC. The…

A: Operon is the gene regulatory mechanism in prokaryotes that regulates many genes that are involved…

Q: Flippases are enzymes which flip proteins from one face of the phospholipid bilayer to the other…

A: Phospholipid bilayer A hydrophilic exterior and a hydrophobic interior make up the two phospholipid…

Q: Crystal Uric acid Amorphous urates Calcium oxalates Amorphous urates Calcium phosphate Triple…

A: Blood volume and concentration, as well as blood pressure, pH, and glucose levels are all controlled…

Q: 4. In a given population of 1000 individuals, the allele frequencies are a = 0.4 and A = 0.6. What…

A: Given - Population size - 1000 Frequency of occurence of dominant allele (A) - 0.6 Frequency of…

Q: What are dietary supplements and in what situations are they "good" for you? In what situations are…

A: "Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…

Q: Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker…

A: DNA is the genetic material in most living organisms.

Q: The following DNA sequence is found on a chromosome in rice plants: 5’…

A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…

Q: In this program, you are provided with phenotype pair counts of F2 offspring at two research…

A: The F2 cross between the heterozygous F1 offspring must yield the ratio 9:3:3:1 (phenotypic). In the…

Q: Which statement about red algae and green algae is correct? A. Red algae and green algae are both…

A: Introduction Plant-like protists are called as the algae. red and green algae, euglenids, and…

Q: Food-borne pathogens are most commonly identified by _________. pulsed-field gel…

A: Food-borne pathogens the bacteria that contaminate food and produce disease by these bacteria are…

Q: Determine the possible explanation about generating the new kind of antibiotic for the treatment of…

A: Most people infected with toxigenic V. cholerae O1 have asymptomatic illnesses or self-limited…

Q: Resident ER proteins destined to remain in the lumen of the ER are marked by retrieval sequences and…

A: The "Endoplasmic reticulum(ER) plays an important role, and it is where the membranes and their…

Q: A human STR locus contains a tandem repeat (TAGA), where n may be any number between 5 and 15. How…

A: Introduction The traits of a living organism are determined by its genotype. These traits are…

Q: . What is juvenile hormone mimics.

A: Introduction Hormones are defined as chemical messengers that are secreted or released directly into…

Q: Describe the steps including the roll of ion terminals in a neuronal action potential

A: An action potential is created when the voltage difference between the inside and outside of a…

Q: expalin the therapeutic uses of atropine and mepyramine.

A: Atropine is an alkaloid,which is chiefly obtained from Atropa belladonna,It is a member of…

Q: Explain the target microbes/microorganism and mode of action of the antibiotic ofloxacin

A: A quinolone antibiotic called ofloxacin is effective in treating a variety of bacterial illnesses.…

Q: Which of the following is UNTRUE with regards to human gametes and their production: A. Female…

A: A. Female gametes complete Meiosis II only after fertilization - true Explanation - Oogenesis• Each…

Q: Place the following terms in the correct order 1-9 in the movement of actin filaments by myosin…

A: Muscle Contraction Is Triggered When an Action Potential runs along the Nerves to the Muscles.…

Q: The term taphonomy refers to____. a. the classification of organisms in relation to each other b.…

A: Evolution is a steady phenomenon in which transformation of life takes place from simple to complex…

Q: 4. The process of impulse conduction along an efferent myelinated nerve involves transmission along…

A: Introduction Neurons transmit signals electrochemically, indicating that an electrical impulse is…

Q: ABO blood type in humans exhibits codominance and has multiple alleles A, B and O- the A and B…

A: INTRODUCTION Blood grouping There are 4 main blood groups A, B, AB and O. The blood group is…

Q: What will be a flow chart of the function of the heart's blood flow, where it goes and comes back,…

A: The circulatory system has a heart, many "arteries and veins that run throughout the body, and…

Q: Prepare a blended formula for morning preparation with Diet recommended of 1500 kcal, carbohydates…

A: The examples below are effective in tube feedings that have been blended: Grains: boiled white or…

Q: In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand…

A: Introduction : The genetic material in most organisms is DNA or Deoxyribonucleic acid. The…

Q: The movement of glucose across the plasma membrane is determined by: a. Electrochemical gradient O…

A: Plasma membrane is the selectively permeable membrane, which allows the movement of only selective…

Q: 4. Terent. How does the difference between cellulose and glycogen affect their nutritional value to…

A: Complex carbohydrates must be broken down into simple monosaccharides that can be absorbed through…

Q: A student sampled a population of fruit flies in which the percentage of homozygous recessive white…

A: Given the population of fruit flies, where the percentage of homozygous recessive white eyed…

Q: Which among the following statements is CORRECT? The thylakoid membrane, in the chlorophyll,…

A: Introduction Stroma is important as it consists of enzymes required for the fixation of carbon…

Q: The figure below shows the number of chromosomes observed in an actively dividing cell at each stage…

A: Cell division is defined as the process by which a cell, referred to as the parent cell, will divide…

Concept explainers

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.

Question

if the water potential of a dialysis is -4.0 and pressure potential was -2.0 and the solute is sucrose, what was the concentraiont of the sucrose solution? the tempertaure kf the room is 37 c. round tocthe thousands places and don't put the unit

asap

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If there were no aquaporin channels in the collecting duct, ________. you would develop systemic edema you would retain excess Na+ you would lose vitamins and electrolytes you would suffer severe dehydration
________ pressure must be greater on the capillary sideof the filtration membrane to achieve filtration.a. Osmoticb. Hydrostatic
The experimental procedure is changed and a dialysis tubing cell is filledwith 10 mL of 0.8M sucrose solution and 5 mL of 1.0M sodium chloridesolution. It is then placed in a beaker containing distilled water. Predict therate of pressure change and explain your reasoning. Write on your own words. Do not copy and paste it from google or any other third party. See attached data.
The physician ordered 700ml of a special electrolyte solution to flow at 75 gtt/min. The drop factor is 15 gtt/ml. How long will it take in hours and minutes will it take to infuse? using dimensional analysis and show work
the major difference between plasma and interstitial fluid is the absence of plasma proteins from the interstitial. explain how this affects solute distrbution and what kind of correction you would do it if you were measuring solute concentration
If you had dialysis tube that contained 5% NaCl solution and you placedit into a beaker that contained 10% NaCl solution. Which directionwould the NaCl move
The client's arterial blood gas ABG ) results show an increase in pH greater than7.45 , Which condition is most likely contribute to this laboratory value A Renal failure B HyperventilationC ketosisD diarrhoea.
Choose the electrolyte that you think is the most critical to maintain, i.e., the most significant electrolyte that is regulated by the kidneys to maintain normal body function. Indicate where in the nephron (PCT, Loop, DCT) this electrolyte is regulated (appropriate amounts returned to the blood). Determine if an under-regulated (a hyper- condition) or an over-regulated (a hypo- condition) is the most critical of the electrolyte you've chosen that would life threatening. List the correct name of the condition associated with the electrolyte. Explain why you feel this electrolyte condition is the most critical. Your explanation should include the organ system most affected by either the under- or over-regulated electrolyte. You may also want to include conditions or other organ system dysfunctions that could result from your chosen electrolyte condition that contributes to the life-threatening situation. A little research and review of all systems covered in Anatomy &…
Choose the electrolyte that you think is the most critical to maintain, i.e., the most significant electrolyte that is regulated by the kidneys to maintain normal body function. Indicate where in the nephron (PCT, Loop, DCT) this electrolyte is regulated (appropriate amounts returned to the blood). Determine if an under-regulated (a hyper- condition) or an over-regulated (a hypo- condition) is the most critical of the electrolyte you've chosen that would life threatening. List the correct name of the condition associated with the electrolyte. Explain why you feel this electrolyte condition is the most critical. Your explanation should include the organ system most affected by either the under- or over-regulated electrolyte. You may also want to include conditions or other organ system dysfunctions that could result from your chosen electrolyte condition that contributes to the life-threatening situation. A little research and review of all systems covered in Anatomy &…
In dialysis, large molecules are allowed to diffuse through a semi-permeable membrane. True False
an infusion pump is set to administer 75 mL/hr. How many hours will it take for the client to receive 600mL of fluid
In no more than two sentences each describe electroporation