63. A student studying mutations found her amino acid chain was Met-Ile-Gly-Pro-Pro-Pro-Gln-Tyr-Val-Stop The second "Pro" that should not be there shows the mutation is a mutation. A. Frameshift B. Nonsense C. Missense D. Silent

63. A student studying mutations found her amino acid chain was Met-Ile-Gly-Pro-Pro-Pro-Gln-Tyr-Val-Stop The second "Pro" that should not be there shows the mutation is a mutation. A. Frameshift B. Nonsense C. Missense D. Silent

Name: 63. A student studying mutations found her amino acid chain was Met-I
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 63. A student studying mutations found her amino acid chain was Met-Ile-Gly-Pro-Pro-Pro-Gln-Tyr-Val-StopThe second "Pro" that should not be there shows the mutation is a mutation.A. FrameshiftC. MissenseD. SilentB. Nonsense

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
48. Sickle cell anemia (SCA) is an inherited blood disorder resulting from abnormally shaped hemoglobin in red blood cells. Affected individuals often experience anemia and pain caused by blocked blood vessels. SCA is caused by a point mutation in the amino acid chain that results from glutamic acid being replaced by valine.What type of mutation causes sickle cell anemia? Select one: a. frameshift mutation b. substitution c. silent mutation d. deletion
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide. Please explain step-by-step how exactly you go from the DNA sequence given to the final answer.
Describe the effect of this mutation on the amino acid sequence of the beta-gloving polypeptide chain: effect of mutation on codon, which amino acid was changed (#amino acids from beginning of chain), what was the amino acid change (from which amino acid to which amino acid?) also find the reputable published source to support this information
Identify which mutation is most likely to impact the function of the protein it encodes a) silent mutation b) mutation at the third site of a codon c) nonsense mutation d) missense mutation
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide.
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
A SNV mutation that results in an early stop codon is called: A. silent mutation B. silencing mutation C. missense mutation D. nonsense mutation E. frameshift mutation
Plssssssssssss helpppppppp Describe the effect of the substitution mutation in a sequence of amino acids.
What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsense