Question
Asked Oct 17, 2019

30  A DNA sequence encoding a five-amino acid polypeptide is given below.

…ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…

…TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA…

b)Give the sequence and polarity of the mRNA encoding the polypeptide.

 

check_circle

Expert Answer

Step 1

The genetic code is which allows DNA and RNA sequences to be decoded into the amino acids of a protein. Genes that provide instructions for proteins this process expressed in a two-steps.

 

Transcription: it is the process of converting the DNA segment into RNA by enzyme RNA polymerase.

Translation: it is processed in which RNA converts into proteins finally.

 

Step 2

DNA is a double-stranded molecule. Each strand is a polynucleotide composed of adenine (A), thymine(T), cytosine(C), and guanine(G) residues polymerized by dehydration synthesis in linear chains with specific sequences. Each strand has polarity such that the 5'-hydroxyl (or 5'-phospho) group of the first nucleotide begins the strand and the 3'-hydroxyl group of the final nucleotide ends the strand.

 

According to this strand runs 5' to 3' prime. It is also essential to know that the two strands of DNA run antiparallel such that one strand runs 5' -> 3' while the other one runs 3'...

Want to see the full answer?

See Solution

Check out a sample Q&A here.

Want to see this answer and more?

Solutions are written by subject experts who are available 24/7. Questions are typically answered within 1 hour.*

See Solution
*Response times may vary by subject and question.
Tagged in

Science

Biology

Related Biology Q&A

Find answers to questions asked by student like you

Show more Q&A add
question_answer

Q: This organelle is structured such that it possessess four to six stacked, flattened membranous ciste...

A: Organelles are tiny structure present in the cytoplasm of a cell (either eukaryotic or prokaryotic)....

question_answer

Q: What effect will increasing the proportion of unsaturated fatty acids in the bilayer have on the mem...

A: The correct option is (A).

question_answer

Q: DNA-DNA Hybridization: Describe the process and principles behind nucleic acid (DNA-DNA) hybridizati...

A: DNA-DNA hybridization is a technique of molecular biology that measures the degree of similarity bet...

question_answer

Q: 3. List the sequences for the "stop" codons.

A: A codon is a three-nucleotide long stretch present in the messenger RNA (ribonucleic acid). It codes...

question_answer

Q: How do we know that membrane phospholipids regularly intermingle and move laterally, but rarely flip...

A: The cell membrane is also known as a cytoplasmic membrane or plasma membrane or plasmalemma. S.J.Sin...

question_answer

Q: Explain how the hoghly ordered structure of a cell does not conflict with the second law of thermody...

A: The second law of thermodynamics states that the entropy of an isolated system can never decrease ov...

question_answer

Q: Explain how the dendritic length constant changes if More channels are open

A: Dendritic length constant is the distance from the origin of an action potential where its amplitude...

question_answer

Q: (LO 2.12) The enzyme family tRNA synthetase makes the ribosomes that tRNA binds do during translatio...

A: An aminoacyl-tRNA synthetase (aaRS or ARS), also called tRNA-ligase, is an enzyme that attaches the ...

question_answer

Q: Which of the following are reactants of the light reactions of photosynthesis.  A. Glucose  B. Water...

A: Photosynthesis is the process of conversion of light energy using some inorganic compounds into ener...