Which of the following is TRUE about MRNA splicing? O a. Splicing occurs after complete mRNA is released from RNA polymerase O b. The energy involved in splicing is required for phosphodiester bond lornation. O c. Intron removal begins with attack of the 5' splice junction by the branchpoint A O d. The U1 SNRNP recognizes the 3' splice junction. Oe. Introns are removed as linear fragments of RNA that remain bound to the spliceosome.

Which of the following is TRUE about MRNA splicing? O a. Splicing occurs after complete mRNA is released from RNA polymerase O b. The energy involved in splicing is required for phosphodiester bond lornation. O c. Intron removal begins with attack of the 5' splice junction by the branchpoint A O d. The U1 SNRNP recognizes the 3' splice junction. Oe. Introns are removed as linear fragments of RNA that remain bound to the spliceosome.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

what is the translation factors(s) most involved in decoding a) IF1,IF2,IF3 b) N-fMet-tRNAfMet and mRNA c) EF-Tu d) EF-G e) release factor and ribosome recycling factor
Transcription & Translation A. Describe mRNA splicing. B.How do mRNA and rRNA interact? C.How do mRNA and tRNA interact?
Which of the following is a processing step that must happen to mRNA before it is translated? Choose all that apply. A) Addition of a poly-A tail B) Splicing out introns C) annealing into a double-stranded helix D) cleavage E) Addition of a 7-methlguanosine cap
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b. introns.c. poly-A tails.d. 5′ caps.e. spliceosomes.
Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change B. some, but not all , mRNA codons change C. there is no change in mRNA codons D. no correct response Consider the following DNA base sequence 3' TTA ATA 5'. what dipeptide is formed if a DNA point mutation converts ATA to ATG? * A. Cys-Phe B. Tyr-Tyr C. Phe-Leu D. Ser-Tyr Consider the following mRNA base sequence 5' ACC CAC 3', what dipeptide is formed if a point mutation converts ACC to ACU? * A. Thr-His B. Thr-Thr C. His- Ile D. Ile- Asp Which of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids…
a) introns removed b) exons removed c) 5' cap added d) 3' cap added e) poly G tail added to 5' end f) poly A tail added to 3' end g) a cap binding protein added to the 5' end h) poly A binding proteins added i) of these answers, b, c, and f only j) of these answers, a, c, and f only . k) of these answers a, c, f, g, and h only Pre-mRNA must undergo which of the following modifications before leaving the nucleus?
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
What happens immediately after the initiation complex forms during translation? (a) peptide bond formation (b) the DNA associated with the promoter unwinds (c) the small and large subunits of the ribosome come together (d) primers are formed (e) phosphodiester bond formation
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
A mutation in a/ an _____ sequence of a gene would be associated with loss of detectable mRNA from that unit. A) promoter B) exon C) intron D) splice site E) terminator