A human with an XY chromosome pair appears female. What might explain this person's condition?O This person has an extra copy of the SRY gene.O This person suffers from Turner syndrome.O This person has a mutated SRY gene.O This person suffers from Angelmansyndrome.O The XY determination was an error because it is impossible for a human XY individual to be female.

Name: A human with an XY chromosome pair appears female. What might explain
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: A human with an XY chromosome pair appears female. What might explain this person's condition?O This person has an extra copy of the SRY gene.O This person suffers from Turner syndrome.O This person has a mutated SRY gene.O This person suffers from

ANSWER;-c) This person has a mutated SRY gene Explain;- Variations (additionally called changes)…

Science

Biology

A human with an XY chromosome pair appears female. What might explain this person's condition? O This person has an extra copy of the SRY gene. This person suffers from Turner syndrome. This person has a mutated SRY gene. This person suffers from Angelmansyndrome. The XY determination was an error because it is impossible for a human XY individual to be female.

A human with an XY chromosome pair appears female. What might explain this person's condition? O This person has an extra copy of the SRY gene. This person suffers from Turner syndrome. This person has a mutated SRY gene. This person suffers from Angelmansyndrome. The XY determination was an error because it is impossible for a human XY individual to be female.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter14: Human Inheritance

Section: Chapter Questions

Problem 15SA: Match the chromosome terms appropriately. ___ polyploid a. symptoms of a genetic disorder ___...

See similar textbooks

Similar questions

Trisomy 21 is a genetic disorder that occurs when a patient has three copies of chromosome 21 in each cell. Which mutation would MOST likely result in a similar phenotype as trisomy 21?
If we call the amount of DNA per genome “x,” name asituation or situations in diploid organisms in which theamount of DNA per cell isa. xb. 2xc. 4x
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
Cystic fibrosis is a recessive disease that affects many parts of the body, but primarily presents itself through difficulty breathing and through cysts in the pancreas. It is caused by mutations in the gene CFTR. What chromosome is the gene on?
Hi im having some trouble with this question, if someone could help solve these with an explanation it would be very helpful! In cats, a gene on the X chromosome (X-linked) makes the protein amelogenin, which helps direct the formation of tooth enamel. A mutation in an amelogenin allele changes the amino acid sequence of the protein and can cause a condition called amelogenesis imperfecta, leading to defects in a cat’s tooth enamel. In one type of amelogenesis imperfecta in cats, the allele associated with the condition, a, acts in a recessive manner. Its dominant counterpart, A, results in normal levels of amelogenin. Additionally, the dominant allele H at an autosomal locus that regulates the expression of the protein Sonic Hedgehog is responsible for polydactyly (the presence of extra digits on each foot, “double paws”) and the expression of its recessive counterpart h results in the absence of polydactyly (having the 5 digits per front paw, and 4 digits per hind paw). A female cat…
A female fruit fly has one normal X chromosome and one X chromosomewith a deletion. The deletion occurred in the middle ofthe X chromosome and removed about 10% of the entire length ofthe X chromosome. Suppose you stained and observed the chromosomesin salivary gland cells of this female fruit fly. Draw thepolytene arm of the X chromosome. Explain your drawing.
Chorionic villus sampling is a procedure to determine if there are any abnormalities in chromosome number in the fetus. Why can the chorionic villi be used to determine abnormalities in the fetus?
Which types of mutations cause (1 word) a. Increase amount of genetic material in particular chromosome b increase amount of genetic material in all chromosomes c decreased amount of generic material in particular chromsomes d change to position of dna sequence in singular chromosome without changing the amount of genetic material e move dna from one chromosome to non homologous chromosome
Describe when X-chromosome inactivation occurs and how thisleads to phenotypic results at the organism level. In your answer,you should explain why XCI causes results such as variegated coatpatterns in mammals. Why do two different calico cats have theirpatches of orange and black fur in different places? Explainwhether or not a variegated coat pattern due to XCI could occur inmarsupials.
A mechanism that may cause a translocation isa. the joining of reactive ends when two different chromosomesbreak.b. crossing over between nonhomologous chromosomes.c. crossing over between homologous chromosomes.d. either a or b.
In a college genetics laboratory course, a healthy student constructs a karyotype from a cell from inside her cheek. She finds only one chromosome 3 and one chromosome 21, plus two unusual chromosomes that do not seem to have matching partners. a. What type of chromosomal abnormality does she have? b. Why doesn’t she have any symptoms? c. Would you expect any of her relatives to have particular medical problems?
You engineer a chromosomally XY mouse in which SRY gene is inactivated. What do you expect to observe in this mouse? a) the mouse will develop male anatomical feautures b) the mouse will develop female anatomical feautures c)the mouse Y chromosome will convert into an X chromosome d) the mouse X chromosome will convert into a Y chromosome e) the mouse will exhibit an additional X chromosome making it XXY