The image below shows a standard human karyotype, from a metaphase cell. Notethat the positioning of the chromosomes in the image is to aid visualization; they arenot lined up this way in the cell.Вох 1Вох 25器 1 88910111213141516 1718192021 222012 Pearson Education, heIf this individual is heterozygous for a gene on chromosome 1, with alleles A and a,what alleles could be represented in the chromosomes in Box 1? Select all that arecorrect. Assume that the image represents a mitotic cell.a. A onlyb. a onlyc. Both A and a

According to the question, we have to mention what alleles could be represented in chromosome box 1,…

The image below shows a standard human karyotype, from a metaphase cell. Note that the positioning of the chromosomes in the image is to aid visualization; they are not lined up this way in the cell. Вох 1 Воx 2 5 器 8 7 10 11 12 13 14 15 16 17 18 19 20 21 22 * 2012 Pewson tducton, he If this individual is heterozygous for a gene on chromosome 1, with alleles A and a, what alleles could be represented in the chromosomes in Box 1? Select all that are correct. Assume that the image represents a mitotic cell. O a. A only O b. a only O c. Both A and a

The image below shows a standard human karyotype, from a metaphase cell. Note that the positioning of the chromosomes in the image is to aid visualization; they are not lined up this way in the cell. Вох 1 Воx 2 5 器 8 7 10 11 12 13 14 15 16 17 18 19 20 21 22 * 2012 Pewson tducton, he If this individual is heterozygous for a gene on chromosome 1, with alleles A and a, what alleles could be represented in the chromosomes in Box 1? Select all that are correct. Assume that the image represents a mitotic cell. O a. A only O b. a only O c. Both A and a

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter6: Cytogenetics: Karyotypes And Chromosome Aberrations

Section: Chapter Questions

Problem 3QP: A colleague e-mails you saying that she has identified an interesting chromosome variation at 21q13....

See similar textbooks

Similar questions

Choose the phrase from the right column that best fitsthe term in the left column.a. DNA polymorphism 1. DNA element composed of shorttandemly repeated sequencesb. phase 2. two different nucleotides appearat the same position in genomicDNA from different individualsc. informative cross 3. arrangement of alleles of twolinked genes in a diploidd. ASO 4. location on a chromosomee. SNP 5. a DNA sequence that occurs intwo or more variant formsf. DNA fingerprinting 6. a short oligonucleotide that willhybridize to only one allele at achosen SNP locusg. SSR 7. detection of genotype at anumber of unlinked highlypolymorphic locih. locus 8. allows identification of a gamete asrecombinant or nonrecombinanti. compound 9. all exons in a genomeheterozygotej. exome 10. individual with two differentmutations in the same gene
A cell has two pairs of submetacentric chromosomes, which we will call chromosomes Ia, Ib, IIa, and IIb (chromosomes Ia and Ib are homologs, and chromosomes IIa and IIb are homologs). Allele M is located on the long arm of chromosome Ia, and allele m is located at the same position on chromosome Ib. Allele P is located on the short arm of chromosome Ia, and allele p is located at the same position on chromosome Ib. Allele R is located on chromosome IIa and allele r is located at the same position on chromosome IIb.a. Draw these chromosomes, identifying genes M, m, P, p, R, and r, as they might appear in metaphase I of meiosis. Assume that there is no crossing over.b. Taking into consideration the random separation of chromosomes in anaphase I, draw the chromosomes (with genes identified) present in all possible types of gametes that might result from this cell’s undergoing meiosis. Assume that there is no crossing over.
During a practical, a group of biology students are tasked to study the cell cycle of an insect. This insect has the karyotype 2n=6, with genotype Aa Bb Ee HH. The students must draw a G2 cell about to enter meiosis, using red lines for maternal chromosomes, blue lines for paternal chromosomes and black dots to represent centromeres. The drawing provided by the students is shown below. a) Identify three mistakes the students made when producing this diagram. In your answer only refer to elements already present in the figure. (3) b) This fly is used in a testcross. What is the probability of producing a fly with genotype Aa bb ee Hh?
If we call the amount of DNA per genome “x,” name asituation or situations in diploid organisms in which theamount of DNA per cell isa. xb. 2xc. 4x
In the figure below, black and pink lines are used to represent nonhomologous chromosomes. Which of the figures matches the following descriptions? More than one diagram may correspond to any one statement, and a diagram may be a correct answer for more than one question. 1) Gametes produced by a reciprocal translocation heterozygote: 2) Genetically balanced gametes produced by a reciprocal translocation heterozygote:
A tomato geneticist attempts to assign five recessivemutations to specific chromosomes by using trisomics.She crosses each homozygous mutant (2n) with each ofthree trisomics, in which chromosomes 1, 7, and 10 takepart. From these crosses, the geneticist selects trisomicprogeny (which are less vigorous) and backcrosses themto the appropriate homozygous recessive. The diploidprogeny from these crosses are examined. Her results, inwhich the ratios are wild type:mutant, are as follows:Which of the mutations can the geneticist assign towhich chromosomes? (Explain your answer fully.)
A woman who sought genetic counseling is found to be heterozygousfor a chromosomal rearrangement between the second andthird chromosomes. Her chromosomes, compared to those in anormal karyotype, are diagrammed on the next page:(a) This woman is phenotypically normal. Does thissurprise you? Why or why not? Under what circumstancesmight you expect a phenotypic effect of such arearrangement?
As a genetic counselor, you may face some ethical dilemmas.Imagine that a couple came to your office to discuss potential color blindness in their children.The man is not color blind, but his wife is. They already have one daughter that is color blindand want to know the probability of future children having the disorder. First, you will need toexplain to the couple the difference between sex chromosomes and autosomal chromosomes andthat color blindness is caused by a recessive mutation in a gene found on the X chromosome.Once they understand this, you can then explain to them the probability of other offspring havingthe disorder. What is the dilemma in this case and why might you need to suggest to the couplethat they see a marriage counselor
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
The Hemoglobin gene has two very common alleles: HbS and HbA. Bob’s professor asks him to draw the chromosomes for an individual that is HbSHbA and label the alleles. Bob draws this (below). Explain why Bob is wrong and then draw it correctly. FOXP2 is a gene in humans; humans that have mutated copies of FOXP2 often have trouble speaking. It is on Chromosome 7, which is about 160 million base pairs long. FOXP2 is at position 115 million base pairs. Which of the drawings below appropriately diagrams the location of FOXP2? Why?
The Pipsy (P) gene can be found on chromosome 6 alongside 3 other genes D, G and T. Based on the recombination frequencies shown below, construct a chromosome map. Please indicate your answer in the following format: ABCD (where the genes are laid out on the chromosome as ABCD). P-D: 5 G-T: 25 D-T: 13 D-G: 12 G-P: 17
You are studying a group of mutations in Drosophila all of which are recessive lethal and map to a small area of chromosome 3. You decide to perform complementation testing to see which mutations are in the same gene. You have bred your flies such that they have the following genotype: +; +; TM3 Sb/mut; + This indicates that chromosomes X, 2, and 4 are wild-type. One copy of chromosome 3 is the balancer TM3 Sb which carries a recessive lethal gene and the dominant marker Stubble (Sb), which causes the flies to have short bristles. The other copy of chromosome 3 carries your recessive lethal mutation. a) Describe how you would maintain each of your individual stocks. What ratios of phenotypes do you expect? b) When you perform your complementation testing, you will have to look at the F1 phenotypes to determine whether two genes complement. Describe what your F1 fly population should look like if the two mutations complement and if they do not. You breed each of your four…