A laboratory measuremere sinds 100 µg of hemoglobin per jal. of blood. Hemoglobin the blood protees that transports oxyger has 10. Estimate the number of molecular weight of 64 kDs or 64.000 a, where 1 daton (Da) 1 atomic mass unit (u)-1.66 hemoglobin proteins in one red blood cell Express your answer in hemoglobin per red blood cell.
Q: can you show how do you do the corss to see the result?
A: This is an example of epistasis where the effect of one gene masks the effect of other gene present…
Q: The figure below is an electron micrograph of the gram-negative bacterium Azotobacter vinelandii,…
A: Bacteria are small microscopic prokaryotic organisms. They lack a true nucleus and other double…
Q: What are sources of bias that we may not even know we have and/or that we use to make sense of the…
A: Introduction :- Bias refers to a systematic error in judgment or decision-making that results from…
Q: 18 True Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Glochidia…
A: Phylogenetic tree is used to represent the evolutionarily relationships among a group of organsisms…
Q: List the approaches used to cultivate viruses, noting which types of viruses are cultivated by each…
A: Virus cultures are laboratory-grown collections of virus particles or virus-infected cells. They are…
Q: Classify each statement as true or false. A mating between SS and Ss individuals will result in all…
A: The procedure of genes being passed from parents to children is referred to as inheritance. Genetic…
Q: A. Explain how mutation causes variation. Give examples. B. Explain how meiosis causes genetic…
A: Introduction In genetics, variation is a critical component of evolution and adaptation, as it…
Q: T F T F T T F F The major bonds in cellulose are a(1-4) bonds. Answer: During mRNA splicing, U2…
A: Introduction :- mRNA splicing is a post-transcriptional process in which introns (non-coding…
Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…
A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…
Q: Organism A and B A and C A and D B and C B and D % DNA Hybridization 5-15 5-15 70-90 10-20 2-5
A: Introduction DNA hybridization is a laboratory technique used to determine the degree of similarity…
Q: Newborns spend the majority of their time O playing O crying O sleeping O eating
A: A Newborn also called a neonate refers to a baby under the age of 28 days. However, some define…
Q: ) List the different levels of the taxonomic classification system, in the order of most inclusive…
A: Introduction: The taxonomic classification system is a hierarchical system used to categorize and…
Q: Which type of transport occurs with water? Carbon dioxide? Glucose? Alcohol? Large proteins?
A: Cellular membranes have two distinct characteristics: 1. They have a semi-permeable barrier (only…
Q: 3. In the space below, draw a mo transport. Include an example of an appr out in Diffusion out in
A: Human body is dynamic as there is continuous exchange and transport of materials from one cell to…
Q: How is collenchyma and sclerenchyma tissue similar
A: Collenchyma, parenchyma, and sclerenchyma are permanent tissues forming the ground tissue in the…
Q: Clinical trials can be designed to demonstrate that a new technology offers measurable, relevant…
A: Clinical trial or often termed "medical trials" are research designs aimed to evaluate the…
Q: In humans, the alleles for blood type are designated IA (A-type blood), IB (B-type blood) and i…
A: The inheritance of blood types in humans is determined by alleles. Different combinations of alleles…
Q: 1) Which statement below about asexual reproduction is FALSE? a) With asexual reproduction,…
A: Introduction : Reproduction is a process by which one organism produces offsprings. There are two…
Q: What is a stele and how did it evolve in plants over time?
A: Introduction : The stele is the central region of the roots and stems. Pericycle, pith, and…
Q: Which nucleic-acid based technique will detect norovirus? A. Fluorescent In Situ Hybridization…
A: Drinking contaminated water can give a norovirus infection. Norovirus is a nonenveloped,…
Q: eologists find a new pyramid containing a mummy's sarcophagus. Many people from different fields of…
A: INTRODUCTION A pyramid is a structure consisting of a base, usually a square or rectangular shape,…
Q: Describe the levels of organisation within the human body
A: The cell is the first level of organisation in the human body. Organs are formed from tissues, which…
Q: In a certain plant, red flowers are dominant over white flowers. A plant heterozygous for red…
A: When two different variants of a trait exist at the gene level, they are referred to as dominant and…
Q: Which event occurs in the first stage of labor? The placenta separates from the uterine wall. The…
A: Labor involves a cascade of events that triggers uterine contractions to deliver the developed baby…
Q: 20. Albinism is a homozygous recessive disorder. The recessive allele results in no melanin…
A: Given that albinism is homozygous recessive. Also, 1 out of 20,000 babies are born with albinism.…
Q: This pedigree shows inheritance of an autosomal recessive condition, with dd individuals having the…
A: Autosomal recessive inheritance is a condition in which a trait passed from parent to offspring.…
Q: Lactose intolerance is caused by reduced production of the enzyme lactase. A variety of digestive…
A: Lactose intolerance is a condition in which the body is unable to digest lactose, a type of sugar…
Q: How does Mendel’s postulates relate to human beings?
A: Gregor Mendel's postulates have revolutionized the way we look at genetics and human biology. His…
Q: A mother wants to find ways to remind her infant of her while she is not there. Which artifact would…
A: A newborn or infants senses are developed but not as precisely as in others.
Q: The pedigree below represents an autosomal recessive disease. What characteristic(s) of the pedigree…
A: Pedigree analysis is the study of family patterns of genetic inheritance, particularly with regard…
Q: True False Glochidia morphology (shape) Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia…
A: The history of the events by which species or other taxa have evolved from a common ancestor is…
Q: Can the mosquito speak? What about the earthworm and malaria plasmodium
A: Speaking is an art and it is a cognitive ability that is controlled by the broca's area present in…
Q: Q: In a certain species of plants, violet flower color (V) is dominant over white flower color (v).…
A: The Hardy-Weinberg Equilibrium presents an equation that may be used to compute allele frequencies…
Q: A population of 600 scorpions was split into four populations when irrigation canals were built…
A: Introduction :- Genetic drift is a random fluctuation in the frequency of alleles in a population…
Q: 11.12 In jimsonweed, purple flower (P) is dominant to white (p) and spiny pods (S) are dominant to…
A: Introduction Dominant and recessive are terms used to describe the relationship between two…
Q: Match the following terms to their definition below: continuation, evergreening, divisional, picket…
A: Due to the various inventions that the original application claimed, an inventor may divide an…
Q: ummarize the theories on how life on Earth began A. Inorganic molecule form organic molecules. B.…
A: Introduction: Abiogenesis is a scientific theory that explains the origin of life from non-living…
Q: 5 1. Based on the data you collected, which are larger: bacteria (represented by E. coli) or…
A:
Q: Dr. Thompson learned in her university genetics course to memorize probability outcomes from…
A: The inheritance is encoded by two genes. These are M and N genes. M gene has two alleles. These are…
Q: Part 1 and Pa
A: Introduction: Genetic variation refers to differences in DNA sequence, gene expression, or phenotype…
Q: A blastocyst is about 2 weeks old. Implantation is important at this stage because the cells need an…
A: Early human embryos go through the blastocyst stage, which is characterised by a spherical structure…
Q: This diagram shows two homologous chromosome pairs from a mouse after DNA replication. Chromosomes…
A: Cell cycle is series of events. It is responsible for dividing the parents and into daughter cells.…
Q: Passive nonvoluntary euthanasia is the one kind of euthanasia that is almost always morally…
A: Euthanasia is the act of intentionally ending the life of a person in order to relieve them of…
Q: Question: What are pharyngeal pouches? a) Is a grandulan groove in the floor of the pharynx and is…
A: Introduction Pharyngeal pouches are folds in the embryonic stage of chordates that give rise to…
Q: Jewel Case has blood type A Rh+, and her husband Derek Case has blood type B Rh+. They have just had…
A: Blood group of an individual can be determined by presence absence of antigen on RBC surface and…
Q: Gram-negative bacteria are not killed by penicillin because they: do not have ribosomes.…
A: Bacteria can be gram-positive or gram-negative depending on how they are stained. Christian Gram…
Q: What is the relationship between the structures (tissues and cells) and their location with respect…
A: In plants different types of tissues are found at different locations. These plants perform…
Q: The function of a neurotransmitter is:
A: Introduction A neurotransmitter is a chemical messenger that plays a crucial role in the…
Q: ssify each statement as true or false. The progeny of a mating between two pure-breeding plants, one…
A: Introduction : Dominant allele is able to express itself even in the presence of its recessive…
Q: 25. Common factors affecting membrane fluidity include a.) temperature. b.) presence of cholesterol.…
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A typical human body contains between 9 and 12 pints of blood. A woman's body contains 11.57 pints of blood and the density of hemoglobin in her blood is 13.5 g/dL. What is the mass in grams of hemoglobin that would be found in 11.57 pints of her blood?Predict the diffusivity of human serum albumin at 293 K in water as a dilute solution and compare it with experimental data. Assume the following: The molecular weight of human serum albumin, MA= 72,300 kg/kmol The viscosity of water at 293 K is 0.897 x 10-3 Pa∙s The experimental data value is 5.93 x 10-11 m2/s.The molecular weight of ethanol (CH3CH2OH) is46 and its density is 0.789 g/cm3.A. What is the molarity of ethanol in beer that is 5%ethanol by volume? [Alcohol content of beer varies fromabout 4% (lite beer) to 8% (stout beer).]B. The legal limit for a driver’s blood alcohol contentvaries, but 80 mg of ethanol per 100 mL of blood (usuallyreferred to as a blood alcohol level of 0.08) is typical. Whatis the molarity of ethanol in a person at this legal limit?C. How many 12-oz (355-mL) bottles of 5% beer coulda 70-kg person drink and remain under the legal limit? A70-kg person contains about 40 liters of water. Ignore themetabolism of ethanol, and assume that the water contentof the person remains constant.
- Hemoglobin is 6.0% heme (C₃₄H₃₂FeN₄O₄) by mass. Toremove the heme, hemoglobin is treated with acetic acid andNaCl to form hemin (C₃₄H₃₂N₄O₄FeCl). At a crime scene, ablood sample contains 0.65 g of hemoglobin. (a) How manygrams of heme are in the sample? (b) How many moles of heme?(c) How many grams of Fe? (d) How many grams of hemincould be formed for a forensic chemist to measure?Carbon dioxide is dissolved in blood (pH 7.4) to form a mixture of carbonicacid and bicarbonate. Neglecting free CO2, what fraction will be present as carbonic acid? Would you expect a significant amount of carbonate (CO32-)?Normal Hgb is referred to as HbA and contains 4 subunits, 2 α-globin chains and 2 β-globin chains, arranged as two dimers of αβ. In Sickle Cell Disease, both β-globin chains are altered in the dimers (αβS/αβS). Q3: Which level of structure does the αβ/αβ and αβS/αβS in HbA and HbS describe?
- Hemoglobin has a molecular weight 16,000 Daltons. convert hemoglobin concentration from 13 g/dL to millimoles per liter.Given the equation of the line, y=150x-8.1221 (cells per mL is in 10^8), what is the CFU per mL of the original suspension if the thousand-fold dilution of that suspension has an absorbance of 0.3 at 600nm? * A. 3.7 x 10^12 B. 3.7 x 10^9 C. 3.7 x 10^1 D. None of these is correctThe normal concentration of Ca2+ in blood is 5.0 mEq>L. How many milligrams of Ca2+ are in 1.00 L of blood?
- You are given a 27 % (w/v) solution of psicose. Molar mass: psicose (C6H12O6) = 180.156 g/mol. ou have a 0.75 mg/mL solution of bovine serum albumin (BSA). You add 1 mL of the 0.75 mg/mL BSA solution into a standard cuvette (1 cm path length), set your spectrophotometer to 280 nm and read the absorbance of this BSA solution. Molecular mass of bovine serum albumin = 66.4 kDa. Molar extinction coefficient (e) of BSA = 43824 M-1 cm-1 (at 280 nm). What absorbance reading will you obtain?A team of biochemists uses genetic engineering to modify the interface region between hemoglobin subunits. The resulting hemoglobin variants exist in solution primarily as αβ dimers (few, if any, α2β2 tetramers form). Are these variants likely to bind oxygen more weakly or more tightly? Explain your answer.The primary structure of mammalian hemoglobin, an a202 tetramer, is approximately. O 2% 18% Ο 50% Ο 78% 0 986 identical to myoglobin