A light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate total length of DNA in all the undergraduate students studying at Cardiff University given that:  (i) the human haploid genome comprises approx. 3.2 x 109 base-pairs (bp) DNA; (ii) 10 bp of DNA has a length of approx. 3.4 nm, (iii) an adult human is constructed from about 3.7 x 1013 cells (Bianconi et al,  (2013), Ann Hum Biol 40, 463–471). (iv) There are approx. 23,800 undergraduate students at the University.  Show your calculations in full.

A light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate total length of DNA in all the undergraduate students studying at Cardiff University given that:  (i) the human haploid genome comprises approx. 3.2 x 109 base-pairs (bp) DNA; (ii) 10 bp of DNA has a length of approx. 3.4 nm, (iii) an adult human is constructed from about 3.7 x 1013 cells (Bianconi et al,  (2013), Ann Hum Biol 40, 463–471). (iv) There are approx. 23,800 undergraduate students at the University.  Show your calculations in full.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 12TYK

See similar textbooks

Similar questions

2b) If you denatured the random 1000 bp fragments of potoroo DNA by heating them to 95°C. and then cooled them down to 60°C and allowed them to reanneal, you would find that approximately 20% of the DNA fragments renatured very rapidly, another 30% of the DNAfragments renatured moderately rapidly, and the remaining DNA fragments renatured relatively slowly. From these results, whatfraction of the potoroo genome is composed of highly repetitiveDNA? helpful Information
Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in mm?
5. If 30% of the bases in human DNA are A, (a) whatpercentage are C? (b) What percentage are T?(c) What percentage are G?
2c) If the whole potoroo genome is 4.2 x 10' bp, and the highlyrepetitive DNA in the potoroo genome is composed entirely ofcopies of the sequence 5'AAGACT' and its complement, howmany copies of this sequence are present in the potoroogenome?
1. Based on Chargaff' s rules, if a segment of DNA is composed of 20% adenine (A) bases, what is the percentage of guanine (G)? 2. Watson and Crick' s discovery of DNA is clearly one of the most important biological discoveries in the last century. What advances in medicine and science can you think of that are built on knowing the structure of DNA? 3. Describe why the structure of DNA led Watson and Crick to point out " a possible copying mechanism for the genetic material. '
7. Each nucleotide pair of a DNA double helix weighs about 1 × 10–21 g. The human body contains approximately 0.5 g of DNA. How many nucleotide pairs of DNA are in the human body? If you assume that all the DNA in human cells is in the B-DNA form, how far would the DNA of a cell reach if stretched end to end?
3. If the human genome is 3 x 109 bp, the distance between each base pair is 0.34 nm, the diameter of the DNA double helix (form B) is 2 nm, and the volume of a. cylinder is defined by V = πr2h - a) estimate the length of the human genome in cm and b) estimate the volume of the genome in nm3.
31. A great deal of current molecular genetic research is focused on: A) the 97 percent of the human genome that is known to code for proteins B) the 20 percent of the human genome that is known to code for proteins C) the 3 percent of the human genome that is known to code for proteins D) the 1.5 percent of the human genome that is known to code for proteins
5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the previous question, starting at the second base.
1. Describe what you saw on the boundary between the fruit mixture and the alcohol. 2. Based from our previous lessons, draw the a.) chemical and b.) double-helix structure of DNA. Label the DNA components. 3. Why do you think there is a need to mash and strain the fruit to isolate the DNA? 5. Identify the complementary nucleotides for the DNA chain below: 5’ GCATTTAAATTGGGGCGCGTAATGCCGGGGGATTACCCAATATGTAC 3
4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?
______________________________________________________________ 1. People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATCC to GGATCC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test with enzyme BamH to identify the genetic disorder? ( (b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gel