3. If one measures a 20 ul sample of DNA with an absorbance reading at A280 mm of 0.35 and an absorbance reading at A 260 nm of 0.7 C. How much total DNA in ug (micrograms) would be present in a 100 ul sample? D. How do you know the sample is relatively free of protein and contaminants? Please explain •
Q: 29. You have purified plasmid DNA and would like to determine its concentration. You mix 10 µL of…
A: Important properties of DNA ae as follows: As DNA is large molecules so it dissolves in water and…
Q: 1. a) A technologist has a 20µl sample of DNA and adds 5µl of loading dye before adding the total…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 5. Describe the process of DNA sequence of interest detection, using these terms appropriately,…
A: Introduction: DNA sequencing method is used to determine the exact base sequence in a DNA. Three…
Q: 1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What…
A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…
Q: 1. Describe what you saw on the boundary between the fruit mixture and the alcohol. 2. Based from…
A: During cell division, deoxyribonucleic acid (DNA) is an inherited molecule that passes genetic…
Q: 2. Name the first complementary base from the 3' direction. Type your
A: RNA chain is synthesized from the 5' end to the 3'-hydroxyl group of the last ribonucleotide in the…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…
A: DNA polymer: 3'- CAG TTA AGG CTC CTA GGT TA - 5' a) first 5 bases at the 3' end of the…
Q: 1. If 30% of DNA is Adenine, what percent is Thymine?
A: DNA ka double helical structure that consists of sugar phosphate and bases. the sugar that is…
Q: 4) A DNA sample was obtained from a new species of a rabbit. For further investigations, 5.0 mL of…
A:
Q: Which of the following actions in the DNA extraction of strawberry separates the DNA from the rest…
A: You have asked mutiple questions. I will answer the 1st question, as allowed by guidelines. Asked…
Q: You extract DNA from 200 milligram of wheat germ. Your total volume of DNA extraction sample is 500…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA…
A:
Q: what is The entire complement of DNA sequences in an organism.?
A: Genome
Q: You extract DNA from 200 milligram of wheat germ. Your total volume of DNA extraction sample is 500…
A: Given values: Total DNA extracted = 500 μL Total weight of wheat used for DNA extraction = 200 mg…
Q: Which statement on the migration of DNA fragments through agarose gels is false A) Small fragments…
A: Agarose gel electrophoresis is one the technique used in Recombinant DNA Technology and Molecular…
Q: Discuss the reasons proteins were generally favored over DNA as the genetic material before 1940.…
A: DNA and RNA are considered as a genetic material. DNA is inherited or transferred from parents to…
Q: 4) A DNA sample was obtained from a new species of a rabbit. For further investigations, 5.0 mL of…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: 8. Explain how to prepare 3 ml of a solution with a concentration of 2ug/5ml from a stock solution…
A: For the preparation of this solution from a concentrated stock solution the formula V1 x S1 = V2 x…
Q: 5. The A DNA used for digestion was provided at a concentration of 2ug/ul. How much DNA (in…
A: DNA Should be free of contaminants such as phenol, chloroform, alcohol, EDTA, detergents or…
Q: 1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA…
A: Deoxyribonucleic acid DNA isolation is referred to the extraction process of DNA from different…
Q: Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases…
A: J.D Watson and F.H.C.Crick(1935) proposed a double helix model of DNA molecule, this is the widely…
Q: Which statement below explains the trick in sanger sequencing that produces fluorescently labeled…
A: DNA sequencing Sequencing of DNA is a method to know the order of nucleotide bases in a DNA strand.
Q: Considering the technologies that pave the way for the identification of molecules on the basis of…
A: Within the scope of recombinant DNA technology, the technologies that pave the way for the…
Q: Suppose I label the newly synthesized DNA with P, grind up the treated cells and run their single…
A: * DNA was labelled with P32 was grinded and treated cells run through a gel which contains a single…
Q: 4. DNA dissolves in water, but not in ethanol. Explain what happened when the ice cold ethanol came…
A: DNA is the genetic material and it is found in most organisms. DNA extraction is one of the first…
Q: 2. A. B. C. The DNA of each species has a different base composition. Find the base composition of…
A: Nucleotide subunits made up DNA's structure. Deoxyribose along with a phosphate group, and one of…
Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: 1. When you simply look at the banding patterns on the gel from the DNA fingerprint we ran in lab as…
A: Gel electrophoresis is a molecular biology technique that is used commonly after DNA isolation to…
Q: 3. If one measures a 20 ul sample of DNA with an absorbance reading at A280 nm of 0.35 and an…
A: These are questions regarding concentration of DNA.
Q: If you have G-C rich DNA versus A-T rich DNA. (a)Will the melting temperature be the same? Why?…
A: The information in deoxyribonucleic acid is keep as a code created from four chemical bases. Human…
Q: After using the blender to blend the split peas, water, and salt mixture, cheesecloth is used to. .…
A: It is a cotton cloth that is loosely woven and resembles gauze.
Q: A circular, double-stranded DNA contains 2100 base pairs. The solution conditions are such that DNA…
A: Linking number is the topological property of . Linking number is a total of twists and writhes. The…
Q: 5- Which statement is not true for agarose gel electrophoresis? a) DNA fragments are separated based…
A: The technique which is used for the separation of DNA fragments is called agarose gel…
Q: 3. You isolate DNA from 1 ml of a suspension of E. coli cells using the procedure outlined in your…
A: a. 10 μl DNA solution was added to 490 μl buffer to make a total volume of 500 μl. Therefore the…
Q: he figure shows that the average distance between base pairs measured parallel to the axis of a DNA…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: 1. The following gel was produced in manual DNA sequencing. What would the unknown DNA template be…
A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…
Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: 1) The Qiagen DNeasy DNA extraction kit is used to extract DNA from a liver cell line for subsequent…
A: DNA extraction aids in the study of the genetic origins of different illnesses. For the development…
Q: 1. A sample DNA was analyzed. 42% of the nucleotides contained Adenine. Calculate the % of…
A: DNA or deoxyribonucleic acid is the molecule present in almost all the living things that code for…
Q: 3. The data in the following table represent the base composition of two double stranded DNA sources…
A: Ervin Chargaff discovered the Base proportion in double stranded DNA. The findings in his study came…
Q: 1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt…
A: A-DNA is one of the possible double helical structures which DNA can adopt. A-DNA is thought to be…
Q: 1. Which of the following are generated due to the twisting of dsDNA? a. Hydrophobic bonds b. Van…
A: DNA acts as genetic material in most organisms. DNA is a double-helical structure in which two…
Q: 2. A. Proteins stick to DNA through hydrogen bonds. Draw your choice of a correctly hydrogen bonded…
A: Hydrogen bonds are one most most frequently seen chemical bonds in biomolecules , whether it be in…
Q: 2) Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher…
A: 2. Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…
A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: 3. The Watson-Crick model pictures DNA as a as the step. spiral staircase with the as the handrails…
A: The double helical structure of DNA was first proposed by James Watson and Francis Crick. According…
Q: 3. Illustrate a 15 nucleotide DNA molecule. Use the symbols: P for phosphate, S sugar and N…
A: DNA is a polymer of nucleotides which are linked to each other by 3'-5' phosphodiester bond.
Step by step
Solved in 4 steps
- 1. Based on the result of spectrophotometry, what can you say about the quantity and purity of your DNA samples? Why did you get such results? 2. Explain the principle involved in the use of 260/280 absorbance ratio for determining the purity of a given DNA sample1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What if the DNA has 2.5 A260/A280 ratio?1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA sample is below 1.8 A260/A280 so, where did the proteincontamination come from? Note: Cite the in-text citation and references
- When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteriaThe two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide basesHow many uL of DNA would I load into my gel if I am given a stock of 450ug/mL and I want to load 4ug?
- 1) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference. (Word limits: 300) 2) Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher temperatures. (Word Limits: 100)2) Considering the technologies that pave the way for the identification of molecules on the basis of hybridization in the classical sense, within the scope of Recombinant DNA Technology; (20P) a) Which of these is used to identify which macromolecule,b) What do you understand in the context of hybridization and between which molecules there are technique-specificinteractions take placec) “Nylon membrane” or “nitrosdulose” commonly used in these technologieswhy "membranes" are needed,d) Explain how to design an application example for each technique you mentioned.#4 under Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases D. new complimentary strand of DNA
- 1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions proposed by Watson and Crick. 2. Considering the number of base pairs, compute for the actual length of the given DNA strand in micrometer. (1m = 10,000Ao) 3' C G A C T A C 5' 5' G C T G A T G 3'Gel electrophoresis separates nucleic acids on the basis of differences in (a) length (molecular weight) (b) charge (c) nucleotide sequence (d) relative proportions of adenine and guanine (e) relative proportions of thymine and cytosine2. Discuss the reasons proteins were generally favored over DNA as the genetic material before 1940. What was the role of the tetranucleotide hypothesis in this controversy?