blueprint for life?"
Q: Name 2 differences in the structural features of DNA and RNA and indicate the relevance of each diff...
A: RNA and DNA are the two types of nucleic acids present in the living system. Nucleic acids are polym...
Q: Explain your answer in 1-3 sentences only. FOLLOW INSTRUCTION! 1. Lectins are a. sugars specific to ...
A: Lectins are a type of biomolecules found in cells. Lectins are found in lentils, tomatoes, beans, pe...
Q: The membrane phospholipids phosphatidyl serine and phosphatidyl choline are named based on ...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: Draw the following compound. (please provide a clear picture) Gentobiose: 2 Glucose, β-(1,6)
A: Carbohydrates are divided into 3 classes monosaccharide, disaccharide, and polysaccharide....
Q: The authors investigate if the switch from the polymerase to the exonuclease site involves releasing...
A: During DNA replication, accuracy is determined by rate of nucleotide incorporation by DNA polymerase...
Q:
A: Regulatory T cells (Tregs) are a type of T cell that suppresses immunological responses, allowing fo...
Q: Section B: True / False The diagram shows an amino acid in L-configuration. NH, 1. H- CH,OH This sug...
A: All living organisms are made up of cells, which are the most basic unit of life. They are responsib...
Q: Mutarotation affects the reducing property of carbohydrates. True False
A: Mutarotation: It is a spontaneous change that takes place in the optical rotation of alpha and beta...
Q: Assume that the substrate cycle that exists as shown undergoes reciprocal regulation such that the p...
A: Metabolic flux is defined as the rate of the turnover of molecules in the metabolic pathway by using...
Q: Which is found in DNA only?
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each ...
Q: Which test can be used to differentiate fructose and glucose? Barfoed’s Test Bial’s Orci...
A: Various biochemical tests are done in laboratory to detect the presence of biomolecules. Biomolecule...
Q: The following structurally define nucleic acids EXCEPT They are polynucleotides connected covale...
A: Nucleic acids can be Deoxyribonucleic acid (DNA) or Ribonucleic acid (RNA).
Q: Can you make the Materials and Methods of Qualitative reaction of Carbohydrates in a scientific pape...
A: Carbohydrates are compounds with carbon, hydrogen, and oxygen. The qualitative analysis is used for ...
Q: Ben is studying an enzyme-catalyzed reaction. In the reaction, H+ ions are formed. He found that aft...
A: pH has a drastic effect on the rate of an enzyme- catalyzed reaction. The enzyme is more active at a...
Q: Which technique is best for determing the the intracellular localization of a protein? Question...
A: Intracellular localisation of protein is the determination of the cellular components where protein ...
Q: DNA molecules can perform their function in replication and transcription as long as the hydrogen bo...
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each ...
Q: la: The 2x PCR Master mix has four main components. Two of these are PCR Buffer and MgC12. Based on ...
A: There are several questions asked. So we will answer the first 3 question. If you need the answer of...
Q: Enzymes normally enhance the rates of biochemical reactions by preferentially binding and stabilizin...
A: ATP synthase is the enzyme complex that undergoes multiple subunits and thus plays an integral role ...
Q: What is an example of an unusual base pair interaction that is found in RNA but not DNA? 1. G-U ...
A: RNA is composed of nucleotides attached together via phosphodiester bonds. DNA is also composed of n...
Q: For the following pentapeptides: Ser-Glu-Gly-His-Ala and Gly-His-Ala-Glu-Ser Draw the most protonat...
A: For amino acids that have an ionizable side chain, in addition to the pKa values of the alpha amino ...
Q: What are the glycosidic linkages of the trisaccharide shown? α1→6, α1→6 α1→6, β1→6 ...
A: A molecule synthesized by living organisms or cells is referred to as a "biomolecule." Carbohydrates...
Q: 1. The general chemical formula of carbohydrate is: (in 1 to 3 sentences, explain why this is your a...
A: Disclaimer: "Since you have posted multiple questions, we will solve the first question for you. If ...
Q: what factors affect melatonin?
A: Melatonin is a hormone secreted by the pineal gland at night into the circulation and third ventricl...
Q: What is the net charge at pH 7 on a peptide with the following sequence? Gly-Ala-Lys-Phe-Asp-Met-Va...
A: For calculating charge at PH 7, there is a basic short trick PH at 7 = [ RK - DE] Where, R = Argini...
Q: he doctor ordered Ancef 225mg IM every 8 hours. You have on hand a 1 gram vial with the instruction...
A: It is important for patient safety that you should accurately calculate an appropriate dose of a dru...
Q: Please answer this, I really need this. Thankyou!
A: Amylase is an enzyme that works on the hydrolysis of starch and other polysaccharides. Amylase break...
Q: Given the karyotype shown at right, is this a male or a female? Normal or abnormal? What would the p...
A: A set of chromosome of individual or species is called Karyotype. Human Karyotype concists of 23 pai...
Q: What gives the DNA molecule a negative charge? nucleobases deoxyribose ribose phosphate ...
A: All living organisms are made up of cells, which are the most basic unit of life. They are responsib...
Q: CHOH CH,OH CH,OH OH CH OH но OH OH OH Answer: Answer CH,OH CH,OH CH,OH CH,OH он OH OH HO OH OH Answe...
A: Here all four options are of di-saccharides.
Q: The equilibrium constant Kc for the reaction fructose-1,6-diphosphate ⇋ glyceraldehyde-3-phosphat...
A: Gibbs free energy change (delta G) is a quantitative measure of the favorability of a given reaction...
Q: Answer this
A: Multiple questions asked. I can answer only 1st question, as allowed by guidelines. Please repost...
Q: Assume that the complete combustion of one mole of glucose to carbon dioxide and water liberates 287...
A: Here is the complete solution:
Q: Describe the roles of carbohydrates as antigens in the human body and in RBC
A: Carbohydrate antigens are polysaccharides and glycoconjugates of multiple structural configurations....
Q: Kindly answer numbers 1, 2, and 3 please
A: Glycogen is a one of the multibranched polysaccharide of glucose which is serves as a form of energy...
Q: What are SMC proteins? Describe the function of SMC proteins and explain how they might contribute t...
A: Chromosomes must be supercoiled or they would not fit inside the nucleus (5 micrometers) of human ce...
Q: o-H H. Hy-H H. From the N-terminus, this sequence is found on the 125th residue onwards. Based on th...
A: Proteins have different structures at its level of complexity. Simple chain of amino acids forms pri...
Q: Phosphate buffered saline (PBS) is a very common reagent in cell biology labs that do cell culture s...
A: Phosphate-buffered saline (PBS) is a buffer of pH=7.4, that is commonly used in biological studies....
Q: Of the following cell membrane lipids, which one 1) prefers to reside in the inner leaflet (or inner...
A: The cell membrane is also known as the plasma membrane, which maintains the shape of the cell. It is...
Q: Which characteristic is truc of protcins? O Proteins have up to four levels of structure. O Proteins...
A: Proteins are organic compounds which consists of amino acids, which are essential for carrying out b...
Q: Explain with an example the statement: Enzymes enhance reactions but are not consumed in the reacti...
A: Enzymes enhance reaction rate but are not consumed in the reaction
Q: Differentiate the structures and functions of prokaryotic and eukaryotic cell. Provide at-least 3 ex...
A: Cell is the basic structural and functional unit of life.
Q: Kindly refer to the photo attached. thank you
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: Seatwork: Give the name of the followingand identify Nucleotide or nucleoside Sugar 2 NH2 но он NH2 ...
A: All living organisms are made up of cells, which are the most basic unit of life. They are responsib...
Q: What is the distinction between the two classes of Topoisomerases (Topo-I and Topo-II). Write the sc...
A: Topoisomerase is an enzyme which helps DNA to be replicated smoothly.
Q: Does celluloid have something to do with cellulose?
A: Cellulose is a polysaccharide, composed of linear chain of thousands of β(1→4) linked D-glucose unit...
Q: 4. Create an illustrated step-by-step schematic diagram of the following Qualitative test for Lipids...
A: Lipids are the substances that are soluble in organic solvents like chloroform, and ether and insolu...
Q: reate an illustrated step-by-step schematic diagram of the following Qualitative test for Lipids: •...
A: Lipids are a heterogeneous class of naturally occurring biomolecules that are categorized based on t...
Q: Please help me calculate the molecular weight of the unknown amino acid. The following are the given...
A: A zwitterion, which is electrically neutral overall, can exist at a specific pH value. The isoelectr...
Q: What color difference will be observed in glycogen with iodine test or how can iodine test be used t...
A: The iodine test is a qualitative chemical test used to distinguish mono and disaccharides from polys...
Q: o-H H. Hy-H H. From the N-terminus, this sequence is found on the 125th residue onwards. Based on th...
A: Proteins have different structural levels. Simple linear chain of amino acids form primary structure...
Step by step
Solved in 4 steps
- 1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA sample is below 1.8 A260/A280 so, where did the proteincontamination come from? Note: Cite the in-text citation and references1. what are the three main steps of a solid phase DNA extraction? Answer is Lysis, but does not include precipitation and purification 2. ) Most STR fragments used in human forensic analysis are composed of _____ repeats.1) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference. (Word limits: 300) 2) Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher temperatures. (Word Limits: 100)
- 1. Answer the following questions about Extraction of DNA A. (3) types of DNA B. Reagents needed to conplete extraction of DNA C. In DNA denaturation, what are 3 basic steps in DNA extraction?1) What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit this property of DNA (Word count: 200) 2) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a referenceExplain the rationale behind the separation of different cellular components using centrifuge. Explain the importance of adding isopropyl as the final solution to isolate the concentrated DNA. What is the chemistry basis of this step?
- With regard to DNA microarrays, answer the followingquestions:A. What is attached to the slide? Be specific about the numberof spots, the lengths of DNA fragments, and the origin ofthe DNA fragments.B. What is hybridized to the microarray?C. How is hybridization detected?Could you please explain these: 1. Why analyze the unknowns in a (short) serial dilution rather than at a single concentration? 2. Which technique can detect lower concentrations of DNA? Compare the detection limit of the fluorescence approach and the absorbance approach1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
- Show the calculations for the preparation of 0.01%, 0.001%, 0.0001%, 0.00001% standard DNA solutions via serial dilution from a 0.1% stock solution. Prepare 10.0 mL of 0.10% standard DNA solution using acetate buffer pH 4.6 as solvent. Prepare four different concentrations of the 0.10% standard DNA solution from step 1 via serial dilution to obtain 0.01%, 0.001%, 0.0001%, 0.00001% standard DNA solutions. Obtain seven clean and dry test tubes. Place 1.50 mL solutions in each tube as follows: Table 2.1. Set-up for the diphenylamine assay. Test tube # Content 1 (blank) acetate buffer pH 4.6 2 0.10% standard DNA 3 0.01% standard DNA 4 0.001% standard DNA 5 0.0001% standard DNA 6 0.00001% standard DNA 7 DNA extract from Part I Add 3.50 mL diphenylamine reagent to each tube, swirl each tube to thoroughly mix the contents and heat for 10 mins in a boiling water bath. Cool immediately under tap water. Read absorbances at 595 nm.…3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.With regard to dideoxy sequencing, which of the following statementsis false?a. The dideoxy nucleotides are fluorescently labeled.b. The dideoxy nucleotides cannot be incorporated into a growingDNA strand.c. When incorporated into a DNA strand, the dideoxynucleotidesprevent further growth of the strand.d. The dideoxy sequencing method is used to determine the basesequence of DNA.e. The dideoxy sequencing method requires the use of primers.
