3.A newly discovered gene has the following structure:4.08H H1.02| 2.54 ↑1.02↑E E1.67= EXON= INTRONE10.8 kbp3.943.66E = EcoRI siteVARMAANH = Hindill siteHI10.811E E1.761.10Note: Fragment sizes are not to scale and all fragmentlengths are in kilobase pairs (kbp)1Describe how you can determine if the gene is interrupted and, if so, thenumber of interruptions by restriction endonuclease analysis and Southernanalysis.a.Indicate what enzymes you would use for digestion and the gelelectrophoresis pattern of the restriction fragments (draw a diagram of the gelwith fragment positions, indicate field polarity, and direction of migration).Please do single and a double digest of the DNA.b. Draw the appearance of the autoradiogram of the Southern blot afterhybridization with a cDNA probe.

Name: 3.A newly discovered gene has the following structure:4.08H H1.02| 2.
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 3.A newly discovered gene has the following structure:4.08H H1.02| 2.54 ↑1.02↑E E1.67= EXON= INTRONE10.8 kbp3.943.66E = EcoRI siteVARMAANH = Hindill siteHI10.811E E1.761.10Note: Fragment sizes are not to scale and all fragmentlengths are in kilobase

(a) A method used frequently in labs to separate charged molecules like DNA, RNA, and proteins is…

Answered: A newly discovered gene has th 4.08…

Science

Biology

A newly discovered gene has th 4.08 2.54 el H H 1.02 ↓ E E 1.67 E 10.8 kbp 3.94 3.66 H 10.811 E E 1.76 1.10

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 6TYK

See similar textbooks

Similar questions

1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3'Translated, the corresponding protein contains how many amino acids: a) 6 b) 7 c) 8 d) 13
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
1. Which of the following initially comes directly in contact with the mRNA during translation? a. 60s + 40s b. 50s + 30s c. 40s + 30s d. 60s + 50s 2. Which of the following properties of DNA confers to the presence of 5' phosphate and 3' hydroxyl terminal? a. Double helix b. Polarity c. Complementary base pairing d. Resistance to alkali hydrolysis 3. Which of the following are constant throughout the entire nucleic acid structure? a. Sugar and Phosphate b. A-T + G-C c. A-U + G-C d. Deoxyribose and Ribose
5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?
9. You sequence the genomes of four different organisms and compare their sequences over a short regionas shown below.5′ AGGTATATAATTTGCG 3′5′ CAATATAAAACCCTAC 3′5′ GCGTATAAAAGAGCTA 3′5′ TTATATATAAAGAAGT 3′a. Determine the consensus sequence common to thefour regions above.b. Why would you want to define the consensus sequence? How would you decide whether the four sequences were worth comparing to define a consensus?c. How could you use this general strategy for defininga consensus sequence to determine which aminoacids of a protein are most crucial for its function?
1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…
1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle cell hemoglobin:Normal: GGG CTT CTT TTTSickle: GGG CAT CTT TTTa. Transcribe and translate the normal and sickle cell DNA. b. Identify this as a point or frameshift mutation. Explain. c. If the base sequence read GGG CTT CTT AAA instead, would this result in sickle cell hemoglobin? Explain.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.