1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?

Q: geneticist happens upon a gene in humans that is not functional and is not currently being expressed

A: Pseudogenes are those which are present in the genome till now but do not perform any function.

Q: the sequence of a DNA template is 17. What is the sequence of the mRNA that will result from the…

A: Transcription is the process by which RNA is synthesized with the help of DNA. Abrupt changes in the…

Q: 2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence…

A: Introduction :-  The synthesis of m-RNA by using template 3'-5' DNA strand is known as…

Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: 7. How many different mRNAs could specify the amino acid sequence met-phe-ser-pro? 8. Agene contains…

A: Ans 7: Genetic codes are triplet in nature. Genetic codons are degenerate in nature, which means,…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: Write the mRNA sequence that remains after the deletion. Use the codon table to write the sequence…

A:

Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…

A: Only proline amino acid form as second codon is stop codon here

Q: 1. If the gene above is transcribed into a functional mRNA,  a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: 1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…

A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…

Q: 8. Which of the following best describes the messenger RNA (MRNA) molecules found in prokaryotes? A.…

A: Disclaimer : Since you have asked multiple question, we will solve the first question for you. If…

Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…

A: Sickle cell anaemia is an autosomal recessive disorder.

Q: 5. You find a mutant with a 10-bp insertion between the (+1) and the upstream promotor sequences.…

A: The transcription is the process of the mRNA formation from gene or DNA sequence. The mRNA so formed…

Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…

A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: 2. DNA Sequence: TAC TCC GGC TCT CcC AGT TGA ACT Mutated Sequence: TAC ICI GGC TCT CCA AGT TGA ACT…

A: Let us first convert the 3' to 5' DNA sequence into 5' to 3' mRNA sequence and will then translate…

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: 5. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: point mutation - change in single nucleotide sequence which alter the amino acid .

Q: 7. How many different MRNAS could specify the amino acid sequence met-phe-ser-pro? 8. A gene…

A: A messenger RNA (ribonucleic acid) is a single-stranded RNA molecule that is correlated to the gene…

Q: 1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ mRNA: polypeptide chain:

A: (According to our regulations, we are required to answer only the first question in case of multiple…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3     AAU…

A: Ans - a.)  AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…

Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…

A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…

Q: 1. What mRNA sequence is synthesized from a section of DNA that is      3’-TTGACCT-5’?

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: 2. What do you predict would happen if you created-a RNA with an anticodon of 5'-CAA-3' that is…

A: The translation of the proteins takes place as the mRNA having the codons are fitting into the…

Q: Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA…

A: In the formation of mRNA from DNA, base complementarity rules follow. A pairs to U and T pairs to A.…

Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…

A: "Transcription" and "Translation" are two important processes that take place inside the cell for…

Q: What does it mean when we say the genetic code is redundant?     a)  A single codon can specify…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: 1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell…

A: * Sickle cell anemia is blood disorder in which red blood cells becomes mis shapen and turns into…

Q: hypothetical protein is 250 amino acids long how many nucleotides are in the code and sequence of…

A: A hypothetical protein is 250 amino acids.  Each amino acid residue in a polypeptide chain was coded…

Q: 8.) Answer the following questions regarding the following DNA sequence.…

A: During transcription RNA synthesis occurs over DNA and translation or protein synthesis occurs over…

Q: If a mutation occurs in a coding region        a. it will cause a change or changes in the normal…

A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…

Q: What would be the sequence of the bases in the messenger RNA in a 5' to 3' direction?  3.) By using…

A: The synthesis of RNA from DNA is called transcription and the synthesis of the proteins with the…

Q: 5. A DNA sequence of "ACG" will code for the amino acid (LS1- 1) * Second mRNA base U UUU Phe UCU…

A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

A:

Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…

A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…

Q: 1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 -…

A: The protein is synthesized by the translation process. It takes place in the cytoplasm.

Q: 1. (a)  "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…

A: 1.(a)  "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…

Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the…

A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.…

Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…

A: In the given diagram of splice donor site and acceptor site: - Splicing take place when a group of…

Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…

A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…

Q: Which of the following initially comes directly in contact with the mRNA during translation? a. 60s…

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3'    Write the sequence of the DNA…

A: The central dogma of life involves three processes. They are: Replication: In this process, copies…

Q: 2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type…

A: Reversion mutation is one that causes such a change in the gene that does not cause change in…

Q: 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU…

A: DNA replication is a proces by which molecule of DNA is duplicated. DNA replication is necessary to…

Q: Why can introns be of any length?

A: Hey, since there are multiple questions posted, we will answer first question. If you want any…

Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…

A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…

Q: Genetics. How to identify what wrong with it

A: DNA sequencing refers to the overall lab strategy for deciding the specific sequence of nucleotides,…