9. You sequence the genomes of four different organisms and compare their sequences over a short regionas shown below.5′ AGGTATATAATTTGCG 3′5′ CAATATAAAACCCTAC 3′5′ GCGTATAAAAGAGCTA 3′5′ TTATATATAAAGAAGT 3′a. Determine the consensus sequence common to thefour regions above.b. Why would you want to define the consensus sequence? How would you decide whether the four sequences were worth comparing to define a consensus?c. How could you use this general strategy for defininga consensus sequence to determine which aminoacids of a protein are most crucial for its function?

9. You sequence the genomes of four different organisms and compare their sequences over a short regionas shown below.5′ AGGTATATAATTTGCG 3′5′ CAATATAAAACCCTAC 3′5′ GCGTATAAAAGAGCTA 3′5′ TTATATATAAAGAAGT 3′a. Determine the consensus sequence common to thefour regions above.b. Why would you want to define the consensus sequence? How would you decide whether the four sequences were worth comparing to define a consensus?c. How could you use this general strategy for defininga consensus sequence to determine which aminoacids of a protein are most crucial for its function?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 6TYK

See similar textbooks

Similar questions

9. You sequence the genomes of four different organisms and compare their sequences over a short regionas shown below.5′ AGGTATATAATTTGCG 3′5′ CAATATAAAACCCTAC 3′5′ GCGTATAAAAGAGCTA 3′5′ TTATATATAAAGAAGT 3′a. Determine the consensus sequence common to thefour regions above.
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
5'.....GATTGCAT.....3' Which molecule below will hybridize to your sequence of interest? Why? A) 5' -GATTGCAT-3' B) 5' -TACGTTAG -3' C) 5' -CTAACGTA -3' D) 5' -ATGCAATC -3'
3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can determineexactly where a cloned fragment of DNA came fromin the genome by sequencing a few bases and matching that data with genomic information.a. About how many nucleotides of sequence information would you need to determine exactly where afragment is from?b. If you had purified a protein from E. coli cells,roughly how many amino acids of that proteinwould you need to know to establish which geneencoded the protein?c. You determine 100 nucleotides of sequence ofgenomic DNA from a different E. coli strain, butyou cannot find a match in the E. coli K12 genomesequence. How is this possible?
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
3. Come up with a short (<15 bp) genome sequence and a k value that would result in multiple possible assemblies using the DBG algorithm. Show the original sequence, graph, and all valid/possible sequence reconstructions. Explain why your sequence has this property. asap please.
1. What is the difference between an iterated blast (psi-blast) search and a simple blastsearch?2. Arslan sequenced a gene in lab how he will know about the gene either it is noveldiscovery or gene is already present in the database?3. Ruwaifa want to compares a nucleotide query sequence what option he will opt inBLAST and why?4. Uzair has two protein sequences, he want to check their similarities what he will do? What results are expected
1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of DNA that carries the genetic information needed to make a protein c. the structure into which DNA is packaged d. a segment of RNA that carries the genetic information needed to make a protein 2. In the double-stranded DNA, the base pairs are: a. G-A and T-U b. G-C and A-U c. A-T and G-C d. A-U and G-C
1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence
Which of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′