Which of the following initially comes directly in contact with the mRNA during translation? a. 60s + 40s b. 50s + 30s c. 40s + 30s d. 60s + 50s

Q: In problem 2e, how can you identify added mutations?

A: Mutations are changes in the base pairs of DNA that are heritable to the offspring. Mutations caused…

Q: 1. Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…

A: DNA replication is a mechanism that involves breaking and building bonds. Replication occurs in 3…

Q: 5)Which type of nucleic acid would have the sequence "ACCGAUUG"? a)DNA b)mRNA c)Another type of…

A: Carbohydrates, amino acids, fats, and nucleic acids are the most important biomolecules found in…

Q: 2. The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine…

A: In this question, we are given with a portion of mRNA which has a sequence 5' GACAUGAACAGC 3'. mRNA…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: 7) A strand of MRNA that is 450 nitrogenous bases long will produce a protein containing…

A: Living cells use a collection of rules called the genetic code to translate information found in…

Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…

A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…

A: Defination of the gene :-

Q: 1.Which of the following RNA has a catalytic activity like an enzyme? A. MRNA C. FRNA B. tRNA D.…

A: 1. (C) rRNA 2. (A) deoxythymidine 5'-monophosphate 3. (B) they differ in pitch

Q: 1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A.…

A: Introduction Genetic code or codon is a three letters nucleotide bases present on m RNA which code…

Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…

A: Sickle cell anaemia is an autosomal recessive disorder.

Q: 5' Capping and 3' polyadenylation of eukaryotic mRNA : a. Destabilize MRNA b. are required for…

A: Introduction:: The correct choice is option (b).

Q: 2. A biochemical analysis of an RNA sample showed 40 % ofnitrogenous bases were cytosine (C). What…

A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…

Q: 1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of…

A: Introduction: The changes or alteration in the sequence of DNA is known as mutation.

Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…

A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…

Q: 1. Why Phosphate bond is important in DNA or RNA structure? 2. Why G-C forms three hydrogen bonds…

A: Molecular biology is the branch of science that studies various biological molecules like nucleic…

Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid…

A: DNA is the genetic material as it contains all the information required to make all the proteins and…

Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…

A: Biochemistry is a branch of biology that deals with the structure, function and interaction of…

Q: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…

A: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…

Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…

A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 8. Which RNA molecule is NOT involved in the processes of transcription and translation? A.…

A: RNA or Ribonucleic acid is a type of nucleic acid. Transcription is the process of synthesis of…

Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…

A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: 2. An mRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…

A: Introduction DNA is the hereditary material in humans and almost all other organisms. RNA is used to…

Q: 41. The template strand of a gene has the sequence 3'-TCCCATGAG-5', Which of the following would be…

A: Amino acids are the structural unit of proteins. there are majorly of 20 amino acids which are…

Q: If a mutation occurs in a coding region        a. it will cause a change or changes in the normal…

A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…

Q: 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA.

A: 7. In all living organisms, the material that  contains  the information which is transmitted from…

Q: What are the components of the initiation complex for translation

A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…

Q: 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…

A: 1. The messenger RNA (mRNA) is produced by the process of transcription from a double-stranded DNA…

Q: What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC  d. GAT e.…

A: A genetic codon is a triplet nucleotide sequence of RNA molecules that were formed from the…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…

Q: What happens immediately after the initiation complex forms during translation? (a) peptide bond…

A: Translation is biological process which involves protein synthesis with the help of mRNA i.e.…

Q: 3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in…

A: Question 3 A) TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT  m-RNA sequence: AUG GAU CGC GUG UAC AUC CAC…

Q: 1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction…

A: In a transcription unit; the there are 2 DNA strands. The strand with polarity 3' to 5' is the…

Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…

A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…

Q: 2. A. Proteins stick to DNA through hydrogen bonds. Draw your choice of a correctly hydrogen bonded…

A: Hydrogen bonds are one most most frequently seen chemical bonds in biomolecules , whether it be in…

Q: 1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T. Determine the sequence of…

A: According to the question, one strand of DNA with the base sequence is given, we have to determine…

Q: 6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA-…

A: For the expression of a gene, the nucleotide sequences present in the template strand of DNA are…

Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…

A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…

Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…

A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…

Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…

A:

Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…

A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…

Q: 8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume…

A: