A point mutation occurs in the middle of the coding sequence for agene. Which types of mutations—silent, missense, nonsense, andframeshift—would be most likely to disrupt protein function andwhich would be least likely?

A point mutation occurs in the middle of the coding sequence for agene. Which types of mutations—silent, missense, nonsense, andframeshift—would be most likely to disrupt protein function andwhich would be least likely?

Name: A point mutation occurs in the middle of the coding sequence for agene
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: A point mutation occurs in the middle of the coding sequence for agene. Which types of mutations—silent, missense, nonsense, andframeshift—would be most likely to disrupt protein function andwhich would be least likely?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
Why would the mutation Ile -> Asp be likely to destabilize a protein? Why would the mutation Ile ->Val be likely to destabilize a protein? Why would the mutation Val -> Ile be likely to destabilize a protein?
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation causes a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
How would a substitution mutation in the third nucleotide position of the codons for alanine and valine affect the resulting protein?
if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a mutation, or an anticodon?
Which group is nonpolar and affects gene expression? Which functional group(s) shown above is (are) present in all amino acids? Which functional group shown above can act as a base?
Which amino acid replacement would result in the biggest structural change in a protein if a Cys residue was replaced with Ser or Phe amino acid, and why?
A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.
In most cases, mutations in the core of a protein that replace a smaller nonpolar side chain in the wild-type (e.g., Ala, Val) with a larger nonpolar side chain (e.g., Leu, Ile, Phe, Trp) in the mutant, result in significant destabilization and misfolding of the mutant. What feature of the protein core explains this observation? Why would such a mutation prevent a protein from folding properly?
The effect of base-pair substitution mutations on protein function varies widely from no detectable effect to the complete loss of a protein function. Why the functional consequences of base-pair substitution vary so widely?
Suppose the codon sequence GUGCAAUUCGAGGCC has a single base pair mutation to GUGCAAUUCAAGGCC. If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene? ____________________________.
How would a mutation like R167Q within a protein such as Human yD Crystallin affect its function and structure?