A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain?5'-ATGTCGACAGCCTAA-3'FirstSecond LetterThirdLetterLetterphenylalaninephenylalanineserinetyrosinetyrosinecysteinecysteineUserineleucineserinestopstopAleucineserinestoptryptophanarginineGleucineprolinehistidineleucineprolinehistidinearginineleucineprolineglutamineargininearginineAleucineprolineglutamineisoleucinethreonineasparagineasparaginelysineserineisoleucinethreonineserineAisoleucinethreonineargininemethioninethreoninelysineaspartateargininevalinealanineglycineglycinevalinealanineaspartateCGvalinealanineglutamateglycineglycineAvalinealanineglutamateO Met-lle-Thr-Ala-STOPO Met-Ser-Trp-Arg-STOPO Met-Tyr-Thr-Arg-STOPO Met-Ser-Thr-Ala-STOP

Name: A protein uses a gene template in 3' to 5' direction. What are the am
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain?5'-ATGTCGACAGCCTAA-3'FirstSecond LetterThirdLetterLetterphenylalaninephenylalanineserinetyrosinetyrosinecysteinecysteineUserineleucinese

The protein is synthesized from mRNA by the process of translation. It takes place in cytoplasm of…

Science

Biology

A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter Letter phenylalanine serine tyrosine tyrosine cysteine cysteine phenylalanine serine C leucine serine stop stop leucine serine stop tryptophan G leucine proline histidine arginine leucine proline histidine arginine arginine arginine leucine proline glutamine glutamine A leucine proline isoleucine threonine asparagine asparagine serine isoleucine threonine serine A isoleucine threonine lysine arginine methionine threonine lysine aspartate arginine valine alanine glycine glycine valine alanine aspartate C G valine alanine glutamate glycine glycine A valine alanine glutamate G O Met-lle-Thr-Ala-STOP O Met-Ser-Trp-Arg-STOP O Met-Tyr-Thr-Arg-STOP O Met-Ser-Thr-Ala-STOP

A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter Letter phenylalanine serine tyrosine tyrosine cysteine cysteine phenylalanine serine C leucine serine stop stop leucine serine stop tryptophan G leucine proline histidine arginine leucine proline histidine arginine arginine arginine leucine proline glutamine glutamine A leucine proline isoleucine threonine asparagine asparagine serine isoleucine threonine serine A isoleucine threonine lysine arginine methionine threonine lysine aspartate arginine valine alanine glycine glycine valine alanine aspartate C G valine alanine glutamate glycine glycine A valine alanine glutamate G O Met-lle-Thr-Ala-STOP O Met-Ser-Trp-Arg-STOP O Met-Tyr-Thr-Arg-STOP O Met-Ser-Thr-Ala-STOP

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 1TYK: Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a...

See similar textbooks

Similar questions

Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding daughter strand sequence? A. 3' - GGG - TAT - CTC - TTT - 5' B. 5' - GGG - TAT - CTC - TTT - 3' C. 3' - GGG - UAU - CUC - UUU - 5' D. 5' - GGG - UAU - CUC - UUU - 3'
Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’ 5’-CAUCUG-3’ 3’-CUGCAU-5’ 5’-AUCGAC-3’ 3’-GACGUA-5’ Which tRNA strand is complementary to the first codon in the above mRNA strand? 3’-GAC-5’ 5’-AUG-3’ 3’-CAU-5’ 5’-CAU-3’ 3’-AUG-5’ Which of the following amino acids is coded for by the above tRNA molecule (in a typical eubacterial cell like E. coli)? methionine N-formylmethionine threonine phenylalanine tyrosine
using the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence 5’-TAT-GGC-ATG-3’? Ile-Arg-Pro His-Ala-Ile Tyr-Gly-Met Val-Arg-Tyr Ile-Pro-Tyr
What is the amino acid sequence of the peptide that would be synthesized after transcription and translation of the following piece of template strand DNA? 5' 3' codon translations _________________________ codon amino acid T C A T G C G C A A C A AGU Ser ACG Thr CGU Arg UGU Cys UGC Cys GCA Ala UGA stop
What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'
Which DNA strand is complementary to this template strand: 5’-GACGCT-3’? A. 5’-AGCGTC-3’ 3’-AGCTAG-5’ 5’-GACGCT-3’ 3’-GATCGA-5’ 5’-UCGAUC-3’ Which mRNA strand is transcribed from the above template DNA strand (the original)? 5’-GAUCGA-3’ 3’-CUGCGA-5’ 5’-CUAGCU-3’ 3’-TCGATG-5’ 5’-AGUGUC-3’ Which tRNA anticodon is complementary to the first mRNA codon (above)? 5’-GAU-3’ 3’-UAC-5’ 5’-AGC-3’ 3’-CGU-5’ 5’-GCU-3’
Using the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence 5’-TAT-GGC-ATG-3’? Ile-Pro-Tyr Tyr-Gly-Met Val-Arg-Tyr Ile-Arg-Pro His-Ala-Ile Ile-Pro-Tyr Tyr-Gly-Met Val-Arg-Tyr Ile-Arg-Pro His-Ala-Ile
The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’