Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'

Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'

Name: Given the following stretch of mRNA, what would be the sequence of the
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA?5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5'5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3'5

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
If the mRNA sequence is 5'-UUU-CCC-AAA-3'.The DNA coding strand should be 5'-TTT-CCC-AAA-3' ?The DNA template strand should be 3'-AAA-GGG-TTT-5' ?So in the 5 to 3 direction, the DNA template strand should be 5'TTT-GGG-AAA-3' ?
A polypeptide has the following sequence: Phe-Pro-Lys-Gly. Which of the following sequences in the coding strand of the DNA could code for this peptide? Select all that are correct. A) CTT-GGG-AAA-CCC-TAG B) TTC-CCG-AAG-GGA C) TTT-CCC-AAA-GGG-TGA D) UUC-CCA-AAG-GGU E) TTC-CCA-AAG-GGC F) AAA-GGG-TTT-CCC-ATT
if the following DNA sequence were transcribed, which of the following describes the output of this process? 3'- TCTGGACA-5' A. This would produce a protein that looks like 5'- A G A C C U G U -3' B. This would produce a tRNA that looks like 3'- A G AC C U G U -5' C. This would produce an mRNA that looks like this: 5'- A G AC C U G U -3' D. This would produce an mRNA that looks like 3'- U C U G G A CA -5' E. This would produce another strand of DNA that 0ok like 5-AG ACCT GT-3. ..
Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?
Below is a template strand of DNA. Assume the transcription start site is outside of this sequence so that the whole sequence is transcribed. After the mRNA is made, what amino acid sequence would be translated from this sequence? Translation begins at the first start codon of the mRNA. DNA template strand: 5’ ...ACTGATGCCCATGGC... 3’ a)Met-Pro-Met b)Ala-Met-Gly-Ile-Ser c)Thr-Asp-Ala-His-Gly d)Met-Gly-Ile-Ser
During the termination of translation, what is the correct polypeptide sequence which will be released by the ribosome? 5' - AUG - UAU - CUC - UUU - 3' (mRNA codon sequence) 3' - UAC - AUA - GAG - AAA - 5' (tRNA anticodon sequence) A.START - Tyr - Leu - Phe B. Tyr - Ile - Glu - Lys C. START - Ile - Glu - Lys D. Ser - Tyr - Gly - Cys
A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription? Group of answer choices CGTUUTCAG CGAUUACUG GCUAAUGAC GCTAATGAC
Which DNA strand is complementary to this template strand: 5’-GACGCT-3’? A. 5’-AGCGTC-3’ 3’-AGCTAG-5’ 5’-GACGCT-3’ 3’-GATCGA-5’ 5’-UCGAUC-3’ Which mRNA strand is transcribed from the above template DNA strand (the original)? 5’-GAUCGA-3’ 3’-CUGCGA-5’ 5’-CUAGCU-3’ 3’-TCGATG-5’ 5’-AGUGUC-3’ Which tRNA anticodon is complementary to the first mRNA codon (above)? 5’-GAU-3’ 3’-UAC-5’ 5’-AGC-3’ 3’-CGU-5’ 5’-GCU-3’
How does one label the DNA-strands that look like this--------------------------------------------and mark the four ends with correct designations.The DNA-strand does contain a gene. In and around the gene sequence, mark the following areas with Exon Poly A tail addition signal Promoter Starcodon Introns Stop codon Does the gene from the drawing come from a pro- or a eukaryotic organism?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?