A receptor antagonist is used to O elicit a response by binding to a receptor. O increase a response by binding to a receptor. O prevent the events that occur downstream of a receptor. Oprevents a response by binding to a receptor.
Q: What does NOT describe a starch?
A: Starch is a polysaccharide that is produced by most of green plants for the purpose of storage of…
Q: Which exemplifies substrate level phosphorylation? O Glucose + ATP --> Glucose-6-phosphate…
A: Substrate-level phosphorylation is a metabolism reaction that aids in the transfer of a phosphate…
Q: How many calories of energy/osmole would need to be expended in order to concentrate a solute…
A: Solute = 75 fold Generating a gradient 75 times as much solute on the one side of membrane than the…
Q: In an individual with chronic and excessive alcohol intake, gluconeogenesis is often not favored…
A: Gluconeogenesis is the process of synthesis of glucose molecules from non-carbohydrate sources such…
Q: Whatarethewater-solublevitamins?Describeeachandtheirsources.
A: Introduction: Vitamins are organic compounds required in the diet in minimal amounts to perform a…
Q: 1. What happens to the rate of liver glucose metabolism during moderate intensity exercise? 2. Would…
A: Carbohydrates are the main energy source for body, they broke down in to glucose as the sole ATP…
Q: Which of the following best describes the mechanism of action of a cardiac glycoside? A)…
A: Cardiac glycosides are the compounds that are important for enhancing the force of heart to increase…
Q: On a mass basis, fats are more efficient sources of energy than carbohydrates but carbs may be…
A: Carbohydrates are the basic components of our food. It is organic compounds produced in the…
Q: Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic…
A: Translation is the process where mRNA transcript of a particular gene is decoded to give rise to a…
Q: Use the Michaelis-Menten equation to complete the enzyme kinetic data set, when Km is known to have…
A: Introduction: The theory of enzyme kinetics was proposed by two scientists Leonor Michaelis and…
Q: On the basic structure of fungi especially on the fungal cell membrane, what do you think are the…
A: Fungus is an eukaryotic organism that include yeasts, moulds, mushrooms etc. They are composed of…
Q: Given the knowledge of biochemistry, make a sample outline of a new 24-hour healthy meal. Provide…
A: The human body can be viewed as an engine that releases the energy contained in the foods it…
Q: Multiple Choice - Explain your answer in 3-5 sentences. - answer properly QUESTION: The allosteric…
A: Proteins that behave as physiological catalysts are known as enzymes. Catalysts speed up the…
Q: State other biologically and commercially polysaccharides then give its commercial uses
A: Polysaccharides are the most common type of carbohydrate present in foods. They are biopolymer…
Q: What type of glycosidic bond does the shown disaccharide have? HỌ CH,OH O CH,OHO Но. OH Но. OH
A: The above given disaccharide represents the structure of lactose. Lactose is made up of one molecule…
Q: Failure of anti-oxidant function results in the hydroxylation of an aromatic acid of Enzyme Z and…
A: Sanger DNA sequencing is carried out using ddCCTP for the chain termination. The given peptide is…
Q: The lipase substrate emulsion contains 0.500 mg of olive oil per 3 mL Also, the molar mass of the…
A: The number of moles of a substance is calculated by using the equation, n=mM, where, "n" is the…
Q: fat-soluble vitamins?
A: Fat soluble vitamins:-These vitamins are present in foods containing fats,the body absorbs these…
Q: One treatment for hyperuricemia is administration of xanthine oxidase inhibitors like allopurinol.…
A: Allopurinol is used in the treatment of hyperuricemia and gout. The urate is the final product of…
Q: false about allosteric feedback inhibition
A: Allosteric feedback inhibition The end product of the biosynthetic pathway binds with the…
Q: Use the data below to determine the maximum velocity [in mM/s] of a certain enzyme-catalyzed…
A: We must know the Michaelis Menten equation: V=Vmax [S]Km+ [S]
Q: What is the purpose of the low temperature step in the PCR reaction? a. To allow DNA polymerase to…
A: The denaturation step of PCR is optimized for high temperatures. The annealing step in PCR is…
Q: evidence of Bial's test to show a positive result for the presence of a specific sugar
A: Bial's test is a chemical test used to test for Pentose sugar. It includes chemicals like orcinol,…
Q: 135.) In the citric acid cycle, oxidoreductases are reversible. A) 0 of 4 B) 1 of 4 C) 2 of 4 D) 2…
A: The citric acid cycle oxidizes the acetyl Co-A into the carbon dioxide in the mitochondria. The…
Q: Regarding pathways that feed glycolysis, which of the following statements is false? Mannose is also…
A: The glycolytic pathway metabolizes glucose molecules to synthesize energy in the form of ATP and…
Q: Identify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general…
A: P39086 is an ID for a protein GRIK1_HUMAN that belongs to Homosapiens. It is a protein of 918 amino…
Q: HN H3Ñ® Where on this amino acid does it attach to a primary sequence of a protein and where is the…
A: Given amino acid, Histidine is a basic amino acid. The structure of Histidine is presented as a…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Glucose transporter allows glucose to move only in one direction to prevent loss from the cells.…
A: Permeability barrier and semi permeability of cell membrane are both maintained by lipids.…
Q: Answer the following questions about Extraction of DNA A. (3) types of DNA B. Reagents needed to…
A: Nucleic acids are macromolecules or biopolymers made up of monomers called nucleotides.…
Q: The picture shown depicts what type of compound binding to an enzyme? A) A competitive inhibitor B)…
A: Regulatory enzymes show increased or decreased catalytic activity in response to specific types of…
Q: Predict the relative intensity and wavelength maxima for the given molecules and stated conditions.
A: Intrinsic fluorescence is observed due to three aromatic amino acid residues - phenylalanine,…
Q: ACTIVITY 6.2.7 Describe the common structural features and differences for each pair 1. Cellulose…
A: Glucose is referred as one of the most important sugar and this sugar is also present in blood. It…
Q: 38. "The sterol is a precursor to all compounds except" A.ergosterol B.testosterone C.bile salts…
A: We'll answer the first question since the exact one wasn't specified. Please submit a new question…
Q: a molecule that lowers cholesterol levels in humans interacts with the enzyme HMA-COG reductase. how…
A: Statins are the molecules responsible for lowering the levels of total bad cholesterol,…
Q: In the Krebs Cycle (Citric Acid Cycle), A 4-carbon compound with a 2-carbon unit to yield a 6-carbon…
A: Kreb cycle/ tricarboxylic acid cycle/ citric acid cylce - occur in matrix of mitochondria.
Q: Choose any/all that apply to lipids.
A: Lipids are biological macromolecules, insoluble in water/polar solvents but soluble in non-polar…
Q: Failure of anti-oxidant function results in the hydroxylation of an aromatic acid of Enzyme Z and…
A: It isn't mentioned in the question on which strand of the c-DNA was taken for Sanger sequencing. So…
Q: A protein that has been reversibly denatured has Multiple Choice temporarily lost part or all of its…
A: Each protein has its own distinct sequence of amino acids, and the interactions between these amino…
Q: An alpha-helical structure within a protein is stabilized mostly by O hydrophobic interactions. O…
A: The primary structure of the protein consists of a linear chain of amino acids linked by the peptide…
Q: What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: In the Krebs cycle, acetic acid or its equivalent provides energy to the organism through oxidation,…
Q: Explain the difference between aldoses and ketoses including its configuration of D and L
A: Carbohydrates, proteins, and lipids are macronutrients that supply the body with energy and basic…
Q: Aldolase enzymes have the following rate constants. k₁ = 10³M ¹s¹, k-₁ = 4.4x10 s ¹, k₂ = 10's-¹ -1…
A: Consider the following single substrate (S) enzyme (E) catalyzed reaction mechanism given below E +…
Q: Table Q1(a) shows typical values for the intracellular and extracellular concentrations of the major…
A: All cells have an electrical potential difference or membrane potential across their plasma…
Q: the Km of an enzyme for its substrate tends to be close to the physiological (cellular)…
A: Enzymes are the biological catalyst which to increase the rate of reaction. Km is also called as the…
Q: Why should starch solution be freshly prepared
A: Starch, also known as amylum, is a polymeric carbohydrate made up of several glucose units linked…
Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The TATA box and Initiator element (Inr) is recognized by which protein complex? How tight is this…
A: The sequence TATA can be found in most promoters. This sequence binds RNA polymerase. The TATA box…
Q: Consider 3 molecules of galactose: (write only the whole number; no decimal places) a. How many…
A: Galactose is an aldohexose sugar. The galactose unit is found in the milk sugar known as lactose.…
Q: Complete the table below regarding the different laboratory tests done for Carbohydrates. Only for…
A: There are different types of tests to check the presence of carbohydrates in different chemical…
Step by step
Solved in 3 steps
- When signals bind to the protein receptors, it depends if the receptor is found on the nuclear or cell membrane. genes are turned on or off. gates open up and then there is a cellular response, such as an action potential. the receptor changes its shape in order to bind the signal and to function.Select the statements that correctly describe positive feedback pathways. A sensor/receptor is required to monitor and limit levels. A sensor/receptor is unnecessary to monitor and limit levels.Match the methods of functionality for the nervous system and endrocrine system. uses an electrical signal to trigger a respnse 1. nervous uses a chemical messager to trigger a response 2. endrocrine
- Maximal physiological response to an external stimuli typically occurs when ______ of the receptors are bound by its ligand. A. None of the answers are true. B. All of the answers are true. C. Only a fraction D. 100% E. Most F. at least 50% G. Ligand-bound receptors do not result in any detectable physiological responses.Choose the best term which describe the following statement: antagonist binds to the binding site of receptor and change the shape: Select one: Incorrect Induced fit. Correct induced fit. Signal transduction. Perfect fit.What component of control mechanism produces a response in the body? Group of answer choices stimulus control center receptor effectors
- identify each of the following as the set point, a receptor, the control center or an effector. Brain 98.6 oF Temperature sensitive nerve cells in the skin. Sweat glandsThe concept cells that activate to a picture of Charlie Brown will most likely activate to what other stimuli? a. A picture of Homer Simpsonb. A picture of Snoopyc. A picture of Jim from the officed. A picture of another cartoon bald kidAfter it has been activated a G-protein _______. moves along the inside of the cell's membrane and activates enzymes binds to its receptor in the cell's nucleus and initiates translation travels in the bloodstream to its target cell and then binds to its receptor binds to a receptor on a nearby cell and then activates multiple proteins
- Cells communicate in ways that resemble humancommunication. Decide which of the following forms ofhuman communication are analogous to autocrine, para-crine, endocrine, and synaptic signaling by cells.A. A telephone conversationB. Talking to people at a cocktail partyC. A radio announcementD. Talking to yourselfIn a negative feedback loop, the effector produces changes that are a. in the same direction as the change produced by the initial stimulus. b. opposite in direction to the change produced by the initial stimulus. c. unrelated to the initial stimulus.Relaying a message from a receptor protein to a molecule that performs a specific function within a cell is called ______. selective permeability signal transduction inhibition self-recognition