Answer the following questions about Extraction of DNA A. (3) types of DNA B. Reagents needed to conplete extraction of DNA C. In DNA denaturation, what are 3 basic steps in DNA extraction?
Q: What is Diabetes Mellitus?How and why does it occur?
A: Diabetes takes place while the body frame isn't always capable of absorb sugar (glucose) into its…
Q: 19. For the helix in double-stranded B-form DNA, the majority of the stability of the DNA can be…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the…
Q: Two of the bypass reactions of gluconeogenesis involve: a phosphorylation of ADP using phosphate…
A: Introduction: Gluconeogenesis is the synthesis of glucose or glycogen from a non-carbohydrate…
Q: When the energetic needs of hepatocytes are being met, which of the following occurs? Acetyl-CoA…
A: When carbohydrates are plentiful, the liver not only uses glucose as the primary metabolic fuel, but…
Q: What intermolecular forces hold protein subunits in a quaternary structure?
A: The protein's quaternary structure is the association of several protein chains or substituents into…
Q: The following enzymes are involved in carbohydrate digestion in the microvilli, except?
A: Carbohydrate digestion starts with the mouth itself. The salivary glands present in the mouth…
Q: The origin of the word "enzyme" comes from Greek and means: Group of answer choices in bacterium in…
A: An enzyme is a biological catalyst that increases the rate of biochemical reactions.
Q: Alcohol dehydrogenase is the enzyme that converts alcohols to aldehydes or ketones. Explain how…
A: Alcohol dehydrogenase is the enzyme that converts alcohol into an aldehyde. It is the enzyme that…
Q: describe strategies that are used to manage insect resistance in genetically modified (GM) crop
A: It is estimated that about 15% of world's crop yield is lost to insects or pests. The damage is…
Q: In sickle cell anemia, an inherited form of anemia in which the hemoglobin distorts the red blood…
A: The mutation that alters the codon that codes for a specific amino acid is called missense mutation.…
Q: Which is true about eukaryotic cDNA? Choose all that apply. a. it is constructed from mRNA that…
A: In the laboratory, complementary DNA (cDNA) is made from messenger RNA. Because the transcript of…
Q: The following unsaturated fatty acids can be found in seminal fluid and act on smooth muscles.…
A: Introduction: Fatty acids are an important source of energy. They all have a carboxyl group at one…
Q: Explain the changes that you observed in terms of change in protein structure at the molecular level…
A: Proteins have different levels of conformation, which includes, primary structure, secondary…
Q: Fill up the table by giving examples of common food, their pH range and classification (acidic…
A: The food items we consume are of different pH ranges. The acidic food items are responsible for…
Q: Write a possible mRNA base sequence that would lead to the production of this pentapeptide. (There…
A: mRNA is the abbreviation for messenger RNA, a type of single-stranded RNA involved in protein…
Q: discuss the biosafety issues involved in the use of genetically engineered microorganism.
A: Biotechnology or genetic engineering where organisms including plants, animals and bacteria or…
Q: 8. A paticnt sullering from infectious polyarthritis, has been reeciving prednisone for a long time…
A: Prednisone is a kind of glucocorticoid. It is a prodrug, which means the liver converts it to…
Q: What is the name of the predominant amadori molecule product in the binding of hemoglobin and…
A: Excess glucose can react nonenzymatically with the amino groups of intracellular and extracellular…
Q: Explain the difference between aldoses and ketoses including its configuration of D and L
A: Carbohydrates, proteins, and lipids are macronutrients that supply the body with energy and basic…
Q: What are the two types of polysaccharides that are made up of starch?
A: Polysaccharide which is a type of carbohydrate contains long chain of polymeric carbohydrate which…
Q: Give the name of the enzyme that we have studied this semester that catalyzes the most similar…
A: Coenzyme A (Co A) → -SH group present in coenzyme A is a thiol, it can react with -COOH to form…
Q: Linear homoglycan of glucose connected by α1-4 linkages…
A: Polyssacharides are the long chains of carbohydrate molecules which are composed of several units of…
Q: Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I.…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Which of the following is the correct order of mechanism of how sugar is perceived? Signal…
A: Glucose is a monosaccharide and it is a simple sugar that is the most important source of…
Q: Discuss how P. fluorescens can be modified to make it a more effective biocontrol agent against the…
A: Fluorescent Pseudomonads are part of the Plant Growth Promoting Rhizobacteria (PGPR) family of…
Q: What is the role of decarboxylation in fatty acid synthesis? Describe another process discussed in…
A: Fatty acids are the body's fat-building blocks. Acetyl-CoA is used to make fatty acids. Fatty acid…
Q: ating, occasional clevated blood pressure and increased excitability. itional screening revealed a…
A: Introduction: Catecholamines are a monoamine organic compound that contains a catechol group and a…
Q: a. Is the disaccharide below a non-reducing sugar? yes or no b. The glycosidic linkage in the…
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the…
Q: Amanufacturer of a line of patentmedicines is preparing a production plan on medicines A and B.…
A: Decision variable: A = bottles of medicine A (1000 units) B = bottles of medicine B (1000 units)…
Q: Consider a protein that is composed of two different polypeptide chains held together by several…
A: Proteins are composed of a linear chain of amino acids attached together via peptide bonds. Twenty…
Q: 10. Which of the following sequences would you expect to be a part of a beta turn? O PAAG O PAGA O…
A: Beta- turns are the simplest secondary structure, connecting two helices or sheets. They are…
Q: write the structure of the following nucleotides: 1. 5'-dGMP 2. 5'-dGDP 3. 5'-dGTP 4. 5'-GTP 5.…
A: The nucleotides are the phosphoric acid esters of nucleosides with the phosphate at the C-5'…
Q: 87) For a the viral proteins a. If the viral protein is made in the RER, it will go back to the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: tफकाटक ननी वकट नवींणणणणय हैमकजनाययळे प्B fAtzeorgating a) it is mare highly hydrated. are pressture…
A: The hydrophobic interaction is critical for the stability of several bioactive systems and plays a…
Q: PDB code 7BSJ Questions Q1 - What is the name of the protein Q2 - What does the protein do? Q3…
A: As you asked multiple sub part questions, we are supposed to answer only first 3 subparts for you.…
Q: TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can…
A: DNA replication process is semi conservative. The semi conservative replication of DNA refers to the…
Q: What roles do enzymes play in nature? Group of answer choices A.They have a role in metabolic…
A: Enzymes are proteins that help in biological catalysis.
Q: Match the following methods of Anlaysis v Fractional analysis, methylation, and periodate oxidation…
A: Different chemical, physical and enzymatic methods in several applications of biological, chemical…
Q: the first two reactions in glycolysis associated with unfavorable ∆G° values, i.e., ∆G° > 0, both…
A: Glucose molecules are metabolized through the glycolytic pathway to release energy in the form of…
Q: To establish a standard curve for a BSA standard curve using Bradford, the spectrophotometer…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: What kinds of bonds do lipase break in order to release fatty acids from triacylglycerols?…
A: The lipase enzyme is used by our bodies to break down fats in food so that they can be absorbed.…
Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: can you specify what are they positive for? like Positive for Xanthoproteic test (letters)**…
A: Phenols are compounds that have one or more hydroxyl groups attached to a benzene ring.…
Q: is acetate present in TCA cycle? Are carbon atoms of acetyle-CoA are converted into CO2?
A: The citric acid cycle is an important metabolic process that links sugars, fat, and protein…
Q: A patient is prescribed 15mmol of potassium chloride injection. The ampoule contains 20mmol in 10ml.…
A: Given data A 10 ml ampule contains = 20 mmol
Q: Why should starch solution be freshly prepared
A: Starch, also known as amylum, is a polymeric carbohydrate made up of several glucose units linked…
Q: Complete table 2. * Since you were not able to conduct an actual experiment on these tests, kindly…
A: Bromine test is a qualitative analysis of organic chemistry to detect unsaturation, anilines and…
Q: Why does the adenosine derivative cordycepin inhibit RNA synthesis and how does this support the…
A: The process of transcription involves the synthesis of RNA by DNA dependent RNA Polymerase.
Q: Which of the following reactions is the most exergonic? a Conversion of PEP to Pyruvate b…
A: Exergonic reaction is the reaction in which energy is released when reactants are converted to…
Q: Lipids may originate through carbocation-based condensation of thioesters or by carbanion-based…
A: Lipids are a class of compounds that are insoluble in water and soluble in non-polar solvents.…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. what are the three main steps of a solid phase DNA extraction? Answer is Lysis, but does not include precipitation and purification 2. ) Most STR fragments used in human forensic analysis are composed of _____ repeats.When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
- 1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What if the DNA has 2.5 A260/A280 ratio?1. TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand. b) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand.
- 1. Upon the banana DNA extraction, what do you see in the top portion of the liquid when you look at your container? 2. Is the DNA you extracted pure? What are the possible impurities? 3. What can we do with the DNA once we have purified it? Discuss different techniques and technologies associated with this.18A. How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect nt is incorporated how many equivalents of ATP are required to fix this?1.Photoreactivation is called a direct reversal of DNA damage. Mismatch repair, Nucleotide excision repair and base excision repair correct DNA mismatches and damaged bases, but these systems are not considered direct repair. what two general steps do these indirect repair systems have in common?.
- 2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.#1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C. nitrogen bases D. new copied strand of DNA9. Estimate the sizes of the bands, in each of the lanes for the gel attached below. Then, for each lane, match the fragments created with the set of restriction enzymes used in the digestion of 640 bp DNA.