A red blood cell passes by a cell that has done cellular respiration and, therefore, has a high concentration of carbon dioxide. How would the carbon dioxide enter the red blood cell? O active transport O osmosis O exocytosis

Q: 1. Why are protist, plants, fungi and animals classified into the same domain but into different kin...

A: Introduction All plants, animals, and microbes on the planet are included in taxonomy, which is the ...

Q: What analysis is provided by the study of human age pyramids?

A: A population pyramid which is also known as age pyramid is a graphical representation of distributio...

Q: Suppose you had to design a hypothetical drug for Alzheimer's disease. Which of the following best d...

A: ANSWER;- C.)  A drug that increases the level of APP protein in the neuron. It is a very effective ...

Q: (d) Given below is an apparatus used to study a particular process in plants. Study the same and ans...

A: (i) Ganong's Potometer. (ii) Because not all of the water taken up by the plant is used for transpir...

Q: 7. How is Genomics different from genetics? *

A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...

Q: The divion of the tain which indate the medula oiongata the pons nd the cemtelum The division of the...

A: metencephalon

Q: Using any search engine, look for at least three (3) processes of Plants and Animals: reproduction, ...

A: Both animals and plants uses various organ systems to perform different functions for their survival...

Q: The TCA cycle is an example of __________. ○ catabolism ○ anabolism ○ lithotrophy  ○ autotrophy

A: The sum total of all the reactions that take place inside the body is called as metabolism. This met...

Q: Meaningful evolution occurs when __________. ○ a heritable trait affects survival and fitness ○ a ...

A: Evolution is the change in the characteristics of a species over several generations and relies on t...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: Which of the following statements indicate the function of growth hormone? It controls and regulates...

A: Hormones are chemical substances that act like chemical messanger molecules in body . They are synth...

Q: _1. It is the important organ that controls thought, memory, emotion, touch, motor skills, vision, b...

A:

Q: A 31-year-old woman was diagnosed with serious endogenous depression and was started on treatment wi...

A: Introduction: bioavailability is defined as the fraction (%age) of an administered drug that reaches...

Q: What is one of the main aspects of design for Enhanced Biological Phosphorus Removal (EBPR)?   a) ...

A: EBPR is a sewage treatment method that is used to remove phosphate from sludge (activated).

Q: Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5' ...

A: The mRNA that is produced by the process of transcription undergoes a modification process in order ...

Q: How are chromosomes, DNA, genes, and alleles related?

A:

Q: If the distance between your eye's lens and retina is too short, you will have difficulty seeing obj...

A: Introduction :- The retina is a layer of nerve tissue that covers the inside of the back two-thirds ...

Q: Determine the resulting genes of an offspring using the Punnett square. 1. Ww and YY 2. rr and ss 3....

A: Dominant alleles are represented by capital letters and recessive alleles are represented by small l...

Q: Meiosis occurs in while mitosis occurs in O somatic cells, germ line cells O germ line cells, somati...

A: Meiosis The mechanism through which sexually reproducing creatures make gametes (sex cells), is a n...

Q: What analysis is provided by the study of human age pyramids?

A: Introduction In this question we have to write about the analysis provided by the study of human age...

Q: Select all the statements that are true regarding the drug treatments available for infectious disea...

A: *Infectious diseases are caused by organisms like bacteria and viruses and  fungi and parasites. *Ma...

Q: 1- Determine the classification for the following devices (CE and FDA): A- Single use scalpel B- A d...

A: Introduction:- Medical devices are assigned to one of three regulatory classes based on the level of...

Q: What is the climax stage of an ecological succession?

A: Introduction:- Ecological succession is the process that describes how the structure of a biological...

Q: Why did Staphylococcus aureus appear in golden yellow color. And the way to differentiate between St...

A: Answer : staphylococcus aureus appears golden yellow color because of the carotenoid pigments presen...

Q: How does the vegetal stratification of an ecosystem influence its biological diversity?

A: Im this question we will discuss about how the vegetal stratification of an ecosystem influence it's...

Q: It is important to mention there are benefits of gene patenting. Regarding diseases that do not yet ...

A: Patents: it is a right from the government for manufacturing and sell any new and useful things such...

Q: Compare the developmental stages (cleavage, blastula, gastrula) of the frog with an invertebrate pre...

A: INTRODUCTION Different stages of development of frog and sea urchin is given below.

Q: What makes a species

A: Taxonomy  In biology taxonomy is the classifying group of organisms according to their characters an...

Q: When surface barriers protecting the body are breached, the second line of defense (of the innate im...

A: Inflammation is a normal physiological response of the body to damage caused to tissue. Infection co...

Q: What can you observe when you view a Gram stained-mixture of bacterial specimen?

A: Gram-staining is a technique that helps us to differentiate between Gram-negative and Gram-positive ...

Q: Based on the information above, what can you speculate about the possible evolution of the genes tha...

A: Rab proteins are small GTP-binding proteins within a superfamily of GTPases known as the Ras superfa...

Q: Photosynthesis in some of the crops is efficient at this range of temperature   a. 20°C - 30°C   ...

A: Photosynthesis is the process that produces organic matter from simple inorganic molecules, using su...

Q: Describe how you would experimentally demonstrate that a specific G beta protein subunit is required...

A: Cells communicate with each other via released proteins unique to each kind. Signal transduction pat...

Q: What is Known as photosynthesis?

A: Green plants (autotrophs) are the manufacturers of organic compounds. They are the producers in the ...

Q: For each pigment below tell me which colors and ranges of wavelengths it absorbs the most and which ...

A: * photosynthetic pigments also called as accessory pigments and chloroplast pigments and antenna pig...

Q: You are presented two mammal skulls (not skeletons) you have not seen before. What traits would you ...

A:   Skulls can tell us a lot about an animal’s diet and lifestyle.   The most effective means of ide...

Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...

A: The electron transport chain is a series of reaction in  four protein complexes, taht creating an el...

Q: interaction between cells and their environment

A: Answer :- Cells incorporate signs from their outside and intracellular climate into essential cycles...

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: Flies belong to the order Diptera, which has evolved advanced mechanosensory organs known as haltere...

Q: n Figure 6-6, assess the allele Vfwith respect to the Vbyallele: is it dominant? recessive? codomina...

A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity ...

Q: In understanding nature of science, what practical things do we need to know in understanding the na...

A: Science help to understand concepts and enables them to make informed decisions about scientifically...

Q: a) Provide a description of the the small intestine epithelial cells observed under high power objec...

A: Histopathology:- Small Intestine Mucosa: - Type of Lining: - Simple Columnar Epithelium Morphology:-...

Q: underground into hardened rock. melted rock is READING Diagrans called magma. What causes a sediment...

A: Rocks forms the important part of the earth. The cycle of rock formation is evident as it helps in p...

Q: Aside from skin (an organ), what other structures are in the integumentary system of other animals a...

A: The integumentary system is composed of organs and systems that shield the internal body from harsh ...

Q: Which of the following is NOT one of the roles of algae in nature? O a. Petroleum is the fossil rema...

A: Introduction :  Features of algae : Body is relatively simple unicellular or multicellular thallus ...

Q: What are the characteristics of small intestine epithelial cells and kidney epithelial cells observe...

A: Intestinal epithelial cells are the surface of intestinal epithelium, where they play important role...

Q: If the global average temperature on Earth were to drop 6°C below the current value, what conditions...

A: Dropping of global temperatures by 6 degrees will eventually impact the world as follows: -     ...

Q: Why is estrogen necessary for bone health? O It prevents the activity of osteoclasts O It reduces th...

A: Osteoblasts, bone lining cells, and osteoclasts are present on bone surfaces and are derived from ne...

Q: How are the concepts of "proxy" and "analogy" similar, and how are they used in reconstructions of t...

A: Proxy or equivalent term homologous is a structure inherited from a common ancestor. Analogy or anal...