w example of this type of rock is gaThis Greek hohead is mademarble. MartWhat Are Metamorphic Rocks?In a way, some rocks resultfrom being cooked. They arelassified as metamorphic(met uh-MAWR fik) rocks. The wordHow Do Rocks Change?metamorprock that fomfrom limestoprocess by which rocks are changedfrom one type into another. A cycleis something that happens over andover again.aRocks are always changing. Allrocks are part of the rock cycleThe rock cycle is a never-endingmetamorphic means "changed inform." A metamorphic rock is a rockthat has been changed by heat,pressure, or both. Before the changethe rock may have been any kind ofrock, even another metamorphic rock.Heat from nearby rising magmacan cause a chemical change in theminerals making up a rock. Theweight of rocks stacked on top of arock builds up pressure that cancause the rock to change.Geologists classify metamorphicrocks into two groups. In one grouppressure causes minerals to spreadout in bands. The rocks can breakWhat is the rock cycle?How the Rock Cycle Worksapart along these bands. OnePressing andcementingSandstone(sedimentaryrock)(NIGHS). It can form when graniteor shale is heated underRocks classified in the other groof metamorphic rocks do not havebands of minerals. They do not breiin layers. Marble is one example odthis type of rock. Marble forms whalimestone is heated under pressurepressureWeathering and erosionHeat and PressureOccurs deep undergroundand chemically changesthe rock.Weathering and ErosionWind and water breakup rocks and carry themaway. The sedimentsdrop off in time.PHow do metamorphicWeathering and erosionQuartziteImetamorphicrock)Basaltrocks form?essure(igneous rock)How Rocks Can Be ChangedPressureMeltingCools andhardensLavaMeltingRocks melt deepCools and HardensMagma and lava coolinto hardened rock.below Earth's surface.The undergroundmelted rock iscalled magma.READINGLDiagransWhat causes a sedimentary rockto become a metamorphic rock?LimestoneC 13(sedimentary rock)Marble(metamorphic rodC 12HeatFFPHeat andpressureand erosionWeathering

Rocks forms the important part of the earth. The cycle of rock formation is evident as it helps in…

Answered: underground into hardened rock. melted…

underground into hardened rock. melted rock is READING Diagrans called magma. What causes a sedimentary rock to become a metamorphic rock? C 13

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter19: Life's Origin And Early Evolution

Section: Chapter Questions

Problem 2DAA

See similar textbooks

Related questions

Q: Why are GMOS considered a threat to the environmental safety?

A: GMO stands for Genetically Modified Organism. They are organisms that have had their characteristics...

Q: Match the sense orgs with the type of stinulus they are able to detect Ooo mouth (Choose) ight chemi...

A: Stimulus(plural)/Stimuli(Singular) Any change in an organism's environment that causes to the organi...

Q: If this is set to 100ul, what is the name of this micropipette? O p-2 O p-20 Op-200 p-1000 In two se...

A: An experiment is a process used in the scientific approach to test a hypothesis. The two most import...

Q: The enzyme aromatase is found in the cytoplasm of some cells and converts testosterone to estrogen. ...

A: A. The enzyme will be denatured and the substrate will not bind to the active site. The impact of ...

Q: Which is NOT a component of a Gram-positive bacterium's cell envelope? ○ peptidoglycan ○ N-acetylm...

A: Bacteria are classified according to their nature of cell wall into Gram positive and Gram negative ...

Q: the treatment that utilizes transgenic organisms to mass-produce proteins O stem cell therapy O gene...

A: Recombinant DNA technology plays a major role in modifying the genetic setup of an organism to have ...

Q: In roses, the synthesis of red pigment is produced by two steps in a pathway. gene O magenta interme...

A: Null mutation :- This mutation is type of loss of function mutation, in this mutation the product ma...

Q: 12. Assume that spherical particles with diameter=100 µm and density=1.1 g/cm³ have sedimentation ve...

A: 13. Isopycnic centrifugation is better to separate RNA from protein .

Q: Meiosis produces daughter cells that are mitosis produces daughter cells that are diploid / diploid ...

A: Introduction : Meiosis - it's a cell division process occurs in germ cells. In meiosis from a dip...

Q: The part of the neuron that is usually a single lorg extension that conducts an impulse to a muscle ...

A: Neuron is the nerve impulse producing and transmitting cells in the nervous system. They have the ca...

Q: Consider the following reaction. What is the consequence of the increase of cytosolic CAMP concentra...

A: During fight or flight response, heart rate and blood pressure increases. This means breathing occur...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: During the Paleozoic, many life forms developed hard parts (shells/bones/etc.). Why would it be use...

A: Shelled animals, the majority of which are sea-based, come in a wide range of shapes and sizes. Beac...

Q: After conducting the Gram staining procedures and you observe nothing (you didn’t see anything) in y...

A: Introduction Gram staining, commonly known as Gram's method, is a staining technique that is used to...

Q: 5. The criterion that is used to distinguish the relationship between two species A. Geography B...

A: A species is defined as a group of actually or potentially interbreeding populations that are reprod...

Q: During a car accident, Mrs. Tay loses a large amount of blood. How would this affect the process of ...

A: Introduction: Glomerular Filtration Rate or GFR is the rate at which the kidneys form the filtrate i...

Q: Genetic information has become part of our culture and it is difficult to tell the difference betwee...

A: Introduction :- Genetics is a branch of biology that studies genes, genetic diversity, and heredity ...

Q: In what ways are Leishmania and Trypanosoma similar with each other?

A: Leishmania is an intra cellular protozoan which is known to cause Leishmaniasis and Trypanosoma cruz...

Q: What difference of person to have Muscular body compare to very muscular and extremely? Like three d...

A: The muscular system is in charge of the human body's mobility. Around 700 identified muscles are att...

Q: The energy available to do work in a cell is called: a. thermal energy b. potential energy c. ...

A: Introduction : thermal energy - every objects has thermal energy. It's the movement of molecules w...

Q: 2. In horses, black coat color is influenced by the dominant allele (B) and chestnut coat color is i...

A: The recessive characteristic will only be displayed in offspring with two copies of the recessive ge...

Q: In what ways are mitosis and meiosis different?

A: The fundamental and active biological process by which a parent cell, after replication of it's comp...

Q: The two categories of stem cells in the human body are embryonic stem cells and adult stem cells. Th...

A: All the the answer choices are correct.

Q: What is the hurdle technology used to destry the microbial load in squash soup?

A: Squash soup is a liquid dish and it is present with High nutrients and low calorie i.e low carbs. An...

Q: Four E. coli strains of genotype a+ b- are labeled 1, 2, 3, and 4. Four strains of genotype a- b+ ar...

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...

Q: Skeletal muscles move as coordinated by the nervous system. sympathetic somatic O peripheral O auton...

A: Skeletal muscles/Voluntary muscles Transverse lines are found at regular intervals. Hence these mus...

Q: Brainstem-Controls breathing and heart rate Test 1: Whole Brains (not to scale) Mouse Cat Baboon Hum...

A: Cerebellum is the part which is located at the back of brain underlying the occipital and temporal l...

Q: Why did Staphylococcus aureus appear in golden yellow color. And the way to differentiate between St...

A: Answer : staphylococcus aureus appears golden yellow color because of the carotenoid pigments presen...

Q: 3. What would be the optimum pH for pepsin, an enzyme that breaks down protein in your stomach? Why?

A: ANSWER) The optimum pH for enzyme Pepsin is 2. At 2 pH Pepsin exhibits maximal activity.

Q: The junctions between one neuron and another neuron are called dendrite Oon O myelin sheath 3 oel bo...

A: Neurons/nerve cells are the structural and functional unit of the nervous system. A neuron consists ...

Q: Why are GMOS considered a threat to the environmental safety?

A: Genetically modified organisms (GMOs) A GMO is an organism whose genetic material has been altered ...

Q: why is recombinant DNA is possible becuase we know dna molecules from all organisms share the same c...

A: Yes, it is true that all organisms indeed share the same basic structure of all molecules. But by ev...

Q: For each pigment below tell me which colors and ranges of wavelengths it absorbs the most and which ...

A: * photosynthetic pigments also called as accessory pigments and chloroplast pigments and antenna pig...

Q: Describe the specimen and explain how the presence of fossil bacteria supports the idea that the Ear...

A: Answer : specimen is the term used for the sample of anything which is used for testing and which te...

Q: What is global warming? |

A: Introduction In this question we will discuss about the global warming in below steps.

Q: trace a glucose molecule from starch sitting in the small intestine to a body cell. What is the role...

A: A transepithelial transport mechanism, begun at the apical membrane by the cotransporter SGLT-1, tra...

Q: Select all the following statements that are TRUE regarding viruses: □ All viruses are potentially ...

A: viruses- is a microscopic non cellular living organism. viruses are surrounded by protein coated lay...

Q: After irradiating wild-type cells of Neurospora (a haploid fungus), a geneticist finds two leucine-r...

A: Part A. In the given question, the different types of alleles that are mutant in nature are brought ...

Q: What do we use to try and understand the state (and quantity) of nature? What are some challenges...

A: Definition Nature is defined as the natural Earth and the things on it, or the essence of a person o...

Q: In the Primula plant, the blue flower color is due to malvidin, a pigment encoded by the completely ...

A: Phenotypic ratio i.e. Blue:White will be 4:12 Gene interaction is interaction between the dominant ...

Q: what is the purpose of the nucleous ? - define diploid

A: In biology, a cell is a membrane-bound unit that holds the basic molecules of life and is made up of...

Q: Because snapdragons (Antirrhinum) possess the pigment anthocyanin, they have reddish purple petals.T...

A: Introduction: When none of the factors of a gene is dominant, the phenotype of a heterozygous domina...

Q: GENETICS 1. Which of the following does not belong? A. Seed Color B. Flower Color C. Seed Shape D....

A: 1. There were seven characters selected by Mendel for his experimental work in genetics. 2. Self- po...

Q: QUESTION 4 Which of the following antibody specificities would be a likely hypothesis based on the r...

A: Antibody detection test :- This test is used to detect antibodies.

Q: List at least five things that a circulatory system does to help the body cells. Which of these is m...

A: Circulatory system is a very important part of any living being as it helps to distribute oxygen and...

Q: Which senses are mentioned in the following sentence? "I went outside and felt the cool breeze on my...

A: The sensory nervous system helps us receive the environmental signals and then decode them by sendin...

Q: cite literature that predict an approximate shelf-life of a squash soup

A: Squash soup has a creamy texture and is made from a variety of squash species that not only have gre...

Q: The last taxon you add should be the outgroup. You may need to redraw the tree when you are done to ...

A: Introduction : In phyllogenetic study, out group is the group that don't want to study. In group ...

Q: Suppose you identify a new gene in mice. One of its alleles specifies white fur, another specifies b...

A: Incomplete dominance is a type of inheritance pattern which shows blending of two alleles in F2 gene...

Q: A. When heart muscles due we have a heart attack. Death is usually from lack of O2… but how can that...

A: A circulatory system is composed of the heart that pumps blood and blood vessels (arteries and veins...

Concept explainers

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.

Question

example of this type of rock is ga
This Greek ho
head is made
marble. Mart
What Are Metamorphic Rocks?
In a way, some rocks result
from being cooked. They are
lassified as metamorphic
(met uh-MAWR fik) rocks. The word
How Do Rocks Change?
metamorp
rock that fom
from limesto
process by which rocks are changed
from one type into another. A cycle
is something that happens over and
over again.
a
Rocks are always changing. All
rocks are part of the rock cycle
The rock cycle is a never-ending
metamorphic means "changed in
form." A metamorphic rock is a rock
that has been changed by heat,
pressure, or both. Before the change
the rock may have been any kind of
rock, even another metamorphic rock.
Heat from nearby rising magma
can cause a chemical change in the
minerals making up a rock. The
weight of rocks stacked on top of a
rock builds up pressure that can
cause the rock to change.
Geologists classify metamorphic
rocks into two groups. In one group
pressure causes minerals to spread
out in bands. The rocks can break
What is the rock cycle?
How the Rock Cycle Works
apart along these bands. One
Pressing and
cementing
Sandstone
(sedimentary
rock)
(NIGHS). It can form when granite
or shale is heated under
Rocks classified in the other gro
of metamorphic rocks do not have
bands of minerals. They do not brei
in layers. Marble is one example od
this type of rock. Marble forms wha
limestone is heated under pressure
pressure
Weathering and erosion
Heat and Pressure
Occurs deep underground
and chemically changes
the rock.
Weathering and Erosion
Wind and water break
up rocks and carry them
away. The sediments
drop off in time.
P
How do metamorphic
Weathering and erosion
Quartzite
Imetamorphic
rock)
Basalt
rocks form?
essure
(igneous rock)
How Rocks Can Be Changed
Pressure
Melting
Cools and
hardens
Lava
Melting
Rocks melt deep
Cools and Hardens
Magma and lava cool
into hardened rock.
below Earth's surface.
The underground
melted rock is
called magma.
READING
LDiagrans
What causes a sedimentary rock
to become a metamorphic rock?
Limestone
C 13
(sedimentary rock)
Marble
(metamorphic rod
C 12
Heat
FFP
Heat and
pressure
and erosion
Weathering

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

you are an igneous rock. describe what you experience as you move through the rock cyle
Name the metamorphic rock that will form from clay that becomes a sedimentary rock before pressure and some heat transform it into this metamorphic rock?
Rocks forms when lava erupts, cools, and crystallizes on Earth’s surface.
Discovery of Iridium in the K-Pg Boundary Sequence In the late 1970s, geologist Walter Alvarez was investigating the composition of the K-Pg boundary sequence in different parts of the world. He asked his father, Nobel Prize-winning physicist Luis Alvarez, to help him analyze the elemental composition of the layer. The Alvarezes and their colleagues tested the K-Pg boundary sequence in Italy and Denmark. They discovered that it contains a much higher iridium content than the surrounding rock layers. Some of their results are shown in FIGURE 16.18. Iridium belongs to a group of elements (Appendix I) that are much more abundant in asteroids and other solar system materials than they are in Earths crust. The Alvarez group concluded that the K-Pg boundary sequence must have originated with extraterrestrial material. They calculated that an asteroid 14 kilometers (8.7 miles) in diameter would contain enough iridium to account for the extra iridium in the K-Pg boundary sequence. FIGURE 18.16 Abundance of iridium in and near the K-Pg boundary sequence in Stevns Klint, Denmark. Many rock samples taken from above, below, and at the boundary were tested for iridium content. Depths are given as meters above or below the boundary. The iridium content of an average Earth rock is 0.4 parts per billion (ppd) of iridium. An average metecrite contains about 550 parts per billion of iridium. The photo shows Luis and Walter Alvarez with a section of the boundary sequence. l. What was the iridium content of the K-Pg boundary sequence?
The absolute age of a geological stratum is determined by: a. the thickness of its rocks. b. the particle size in its rocks. c. the types of fossils found within it. d. its position relative to other layers. e. radiometric dating techniques.
Discovery of Iridium in the KPg Boundary Layer In the late 1970s, geologist Walter Alvarez was investigating the composition of the KPg boundary layer in different parts of the world. He asked his father, Nobel Prizewinning physicist Luis Alvarez, to help him analyze the elemental composition of the layer. The Alvarezes and their colleagues tested the K-Pg boundary layer in Italy and Denmark, and discovered that it contains a much higher iridium content than the surrounding rode layers (FIGURE 16.17). Iridium belongs to a group of elements that are much more abundant in asteroids and other solar system materials than they are in Earths crust. The Alvarez group concluded that the KPg boundary layer must have originated with extraterrestrial material. Sample Depth Average Abundance of Iridium (ppb) +2.7m 0.3 +1.2m 0.3 +0.7m 0.36 boundary layer 41.6 0.5 m 0.25 5.4 m 0.30 FIGURE 16.17 Abundance of iridium in and near the KPg boundary layer. Iridium content of rock samples above, below, and at the KPg boundary layer in Stevns Klint, Denmark. Sample depths are given as meters above or below the layer. ppb, parts per billion. An average Earth rock contains 0.4 ppb iridium; the average meteorite, 550 ppb. The photo shows Luis and Walter Alverez next to the KPg boundary layer in Stevns Klint. What was the iridium content of the KPg boundary layer?
Changes in the Air To assess the impact of human activity on the carbon dioxide level in Earths atmosphere, it helps to take a long view. One useful data set comes from deep core samples of Antarctic ice. The oldest ice core that has been fully analyzed dates back a bit more than 400,000 years. Air bubbles trapped in the ice provide information about the gas content in Earths atmosphere at the time the ice formed. Combining ice core data with more recent direct measurements of atmospheric carbon dioxideas in FIGURE 46.13can help scientists put current changes in the atmospheric carbon dioxide into historical perspective. FIGURE 46.13 Changes in atmospheric carbon dioxide levels (in parts per million). Direct measurements began in 1980. Earlier data are based on ice cores. What was the highest carbon dioxide level between 400,000 B.C. and 0 A.D.?
Forces that cause geologic change include _____ (select all that are correct). a. erosion b. natural selection c. volcanic activity d. tectonic plate movement e. wind f. asteroid impacts
Discovery of Iridium in the KPg Boundary Layer In the late 1970s, geologist Walter Alvarez was investigating the composition of the KPg boundary layer in different parts of the world. He asked his father, Nobel Prizewinning physicist Luis Alvarez, to help him analyze the elemental composition of the layer. The Alvarezes and their colleagues tested the K-Pg boundary layer in Italy and Denmark, and discovered that it contains a much higher iridium content than the surrounding rode layers (FIGURE 16.17). Iridium belongs to a group of elements that are much more abundant in asteroids and other solar system materials than they are in Earths crust. The Alvarez group concluded that the KPg boundary layer must have originated with extraterrestrial material. Sample Depth Average Abundance of Iridium (ppb) +2.7m 0.3 +1.2m 0.3 +0.7m 0.36 boundary layer 41.6 0.5 m 0.25 5.4 m 0.30 FIGURE 16.17 Abundance of iridium in and near the KPg boundary layer. Iridium content of rock samples above, below, and at the KPg boundary layer in Stevns Klint, Denmark. Sample depths are given as meters above or below the layer. ppb, parts per billion. An average Earth rock contains 0.4 ppb iridium; the average meteorite, 550 ppb. The photo shows Luis and Walter Alverez next to the KPg boundary layer in Stevns Klint. How much higher was the iridium content of the boundary layer than the sample taken 0.7 meter above it?
Forces that cause geologic change include ___ (select all that are correct). a. erosion b. natural selection c. volcanic activity d. tectonic plate movement e. wind f. meteorite impacts
a. Explain what is meant by plate tectonics. b. In your own words explain what happens at a subduction zone. c. At a subduction zone, what causes magma to rise?
A scientist discovers something new about the composition of the mantle. What type of rock (group) was the scientist studying?