a researcher isolates mRNA from a healthy and diseased liver biopsies. each mRNA sample is converted into cDNA and subjected to next generation sequencing. select all statements that describe this experiment and the possible results the researcher can identify transcripts

a researcher isolates mRNA from a healthy and diseased liver biopsies. each mRNA sample is converted into cDNA and subjected to next generation sequencing. select all statements that describe this experiment and the possible results the researcher can identify transcripts

Name: a researcher isolates mRNA from a healthy and diseased liver biopsies.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: a researcher isolates mRNA from a healthy and diseased liver biopsies. each mRNA sample is converted into cDNA and subjected to next generation sequencing. select all statements that describe this experiment and the possible results the researcher ca

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

NASA has identified a new microbe present on Mars and requests that you determine the genetic code of this organism. To accomplish this goal, you isolate an extract from this microbe that contains all the components necessary for protein synthesis except mRNA. Synthetic mRNAs are added to this extract and the resulting polypeptides are analyzed: Synthetic mRNA Resulting Polypeptides AAAAAAAAAAAAAAAA Lysine-Lysine-Lysine etc. CACACACACACACACA Threonine-Histidine-Threonine-Histidine etc. AACAACAACAACAACA Threonine-Threonine-Threonine etc. Glutamine-Glutamine-Glutamine etc. Asparagine-Asparagine-Asparagine etc. From these data, what specifics can you conclude about the microbe’s genetic code? What is the sequence of the anticodon loop of a tRNA carrying a threonine? If you found that this microbe contained 61 different tRNAs, what could you speculate about the fidelity of translation in this organism?
A bioengineer takes the gene from the human liver cell and insert into a bacterial chromosome. Then, bacteria transcribe this gene into mRNA and translate this mRNA into protein. This protein produced is useless and has been found to contain more amino acid than the protein made by the eukaryotic cell. Please explain the reason for that issue.
Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?
radioactively labeled cDNA is used to probe RNA isolated from kidney by Northern blotting. Twobands are seen on the blot. Which of the following reasons is least possible? A. A single pre mRNA is spliced into two different messagesB. There are two promoters for the geneC. There are two related genes expressed in kidneyD. The mRNA is cleaved in the cytoplasm as part of its degradation Explain why the answer is B or EE. There is a single mRNA produced but some is not polyadenylated
During experimental RNAi, how does the researcher affect expression of a target gene? Group of answer choices Inject custom, lab-made double-stranded RNA into the specimen that will be targeted by the cell's existing Dicer to create siRNA complementary to the target gene's transcript. Inject lab-made Dicer proteins into the specimen which will cut up the target gene's transcript. Inject custom, lab-made siRNAs complementary to the target gene's transcript.
Polygenic mRNAs Choose an answer below: are uncommon in eukaryotes. encode more than one protein. are made from operons in bacteria. a and b, but not c a, b, and c
A monocistronic mRNA is defined by… Group of answer choices The presence of a 5’ triphosphate The absence of introns The presence of one coding sequence The absence of a poly(A) tail Eukaryotic mRNAs are protected on the 5’ end by… Group of answer choices A methylated guanosine A polymer of adenine A triphosphate RNA primer Eukaryotic mRNAs are typically processed in this order: Group of answer choices Introns spliced out, poly(A) tail added, capped Poly(A) tail added, capped, introns spliced out Capped, poly(A) tail added, introns spliced out Capped, introns spliced out, poly(A) tail added
You are studying a rare form of brain cancer where the newly-discovered genes BR and AIN are known to play a role in the development of this cancer. You perform a RNA-seq analysis on a patient with this form of cancer and compare the resulting expression histogram to a healthy patient. You conclude that AIN is heavily upregulated in the cancer patient and that the cancer patient's mRNA for BR retains one of that gene's introns in the RNA-seq results. Based on this information, BR is likely a(n) _________ and AIN is likely a(n) _________ . a. oncogene; tumor-suppressor gene b. tumor-suppressor gene; tumor-suppressor gene c. oncogene; oncogene d. tumor-suppressor gene; viral gene e. tumor-suppressor gene; oncogene
Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!
Which of the following statements is not true about the guide RNA (see this interactive demonstration for help with this question: https://www.biointeractive.org/classroom-resources/crispr-cas9-mechanism-applications) Group of answer choices it contains a sequence of 20 nucleotides that matches a specific sequence in a cell’s DNA When the guide RNA is combined with Cas9, it will guide Cas9 to the target sequence its target sequence can be almost any sequence as long as it occurs near a PAM motif it is a nuclease, a type of enzyme that cleaves DNA
Researchers create a recombinant DNA molecule in which the coding sequence for GFP is inserted downstream of the enhancer/promoter for mouse rhodopsin. Then this DNA is used to to make a trangenic mouse. This is an example of a .... Group of answer choices Expression Vector Positional Clone Reporter Gene
A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter, a wildtype nucleotide sequence and a polyadenylation sequence. However, the gene does not produce a functional protein. Students may submit their answers as bullet points or a table to facilitate grading. Part A: List up to five reasons why this gene is not expressed in E. coli. Part B: What changes do you recommend that would facilitate expression of the eukaryotic gene in E. coli.