Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences)

Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences)

Name: Below is an mRNA molecule in its wild type form.5’ CCGUACAUGGUGAAAAGUC
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Below is an mRNA molecule in its wild type form.5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is:5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and write the mature mRNA sequence. Then write the amino acid sequence of the resulting transcript. AGAGCTACCAGCTTTAGCGGGATATAAACACACTTATCCTACTATCCCTA 51 TCTTCCCCCAAAGAGGGATCATGCCGTCGACGGCCAAACCGATCGAGCGG 101 AGGTTAAGGGCCATTGGAAAAGGACACTCTGTACGACTAAGAAAATAGC 151 AGCGACTGAGCTGAACGCTACGGGGGGGGGGGTATATACCCCCCCCCCCC 201 CCAGCTACGAGCGACTTTTTATTTTTTTTTTTTATTTTTTTTCTTTTTTA 251 TTTTTTTTGTTTTTTTTTTTCGCGACTACAGAGACTTCTAGCGATCGACG 301 AGCTAGCTAGCGCGGCATCGGACGCGATCGCGATCCTAGACTCTACGAT
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C
What would the sequence of the immature mRNA be? Place the sequence of ALL the transcript that would be synthesized from the gene. In each of the available line you should transcribe all nucleotides that form the immature mRNA. If the sequence indicated is not transcribed then write NA. WRITE THE NUCLEOTIDES IN CAPITAL LETTERS. Promoter: EXON 1: Intron 1: Exon 2: Intron 2: Exon 3 without terminator : Exon 3 terminator:
summarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…
For each of the five short mRNA nucleotide sequences given in the table below: 3. Translate the original sequence (for these short sequences start translation at the first nucleotide) 4. Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences 5. For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above) 6. Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If so, what is the effect of the mutation on protein structure (amino acid sequence; see #2 above)