which protein interacts with RNA polymerase, in order to allow RNA polymerase to cleave RNA using the RNA polymerase exonuclease activity

Q: What is the purpose of G1 checkpoint?

A: Introduction :- The G1 checkpoint, also known as the restriction point in mammalian cells and the…

Q: Naked viruses typically exit the cell via this/these processes (may choose more than one).

A: Introduction-  naked viruses typically exits cells via process called lysis, exocytosis and budding.…

Q: Choose 1 biotechnology product in the field of agriculture. Provide a 1-3 minute monologue about…

A: Biotechnology is a branch of technology that is based on biology.  The use of living systems and…

Q: Question 3 This picture shows a non vascular plant. angiosperm. seedless vascular plant. gymnosperm.

A: Identification of both pictures given below. Thank you.

Q: Draw the potential tautomers of Cytosine.

A: At the highest level of theory, the enol form with the hydroxyl hydrogen trans to N3 (tautomer C2t)…

Q: 898/quizzes/4239/4/take Which of the following things is/are true about this organism? unicellular…

A: Kingdom fungi of the biological world comprises of eukaryotic, multicellular, non chlorophyllus,…

Q: Illustrate how SP with specific DNA sequences. initiates double strand breaks (DSBs) after PRDM9…

A:

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: Summarize the research on the ability of animals to communicate and use language.

A: Communication is an essential part of animal life, enabling animals to share information about…

Q: Define Cardiac Output, give its relationship with Stroke Volume.

A: Introduction - The heart is a muscular organ the size of a fist that is placed directly behind and…

Q: (iii) Explain why DNA in the presence of monovalent cations will have a high melting temperature…

A: Melting temperature Tm Tm is defined as the temperature at which 50 percent of the double-stranded…

Q: (muscle type) NN (Neural type). O False True

A: * Nicotinic acetylcholine receptors also known as nAChRs which are the receptor polypeptides that…

Q: Decreased osmolarity in the renal interstitium and vasa recta results in - (Mark Two) decreased…

A: The regulation of water concentration in the body is mediated by a hormone called vasoppresin or ADH…

Q: of these is true about this organism? Check each phrase that is true omain Eukarya otozoan acterium…

A: Some ladder like arrangements of cells shown in the picture. The cells are longer than wider.

Q: Tom and his wife Julie are both carriers for cystic fibrosis, an autosomal recessive disease. Draw a…

A: Cystic fibrosis attacks mainly two parts of the body including the lungs and our whole digestive…

Q: How are ACE1 and ACE2 related to the structure and function of mRNA vaccines (Moderna & Pfizer…

A: Angiotensin converting enzyme (ACE, aka ACE1) is another protein, also found in tissues such as the…

Q: What are the principle and basic concepts of Simple staining

A: The simple staining doesn't give a lot of data about the cell separated from the bacteria'…

Q: A loss of function mutation in both alleles of the Bcl2 gene A loss-of-function mutation in both…

A: For the cell to evade apoptotic pathways, they need to get rid of things which kill the cell as is…

Q: Calculate the estimated population size, N, given a study that initially marked 100 animals and…

A: (11) The method of estimation is called the Lincoln Index P = (N1 x N2 )/ R. P = total size of…

Q: Answer each question in 300 words: 1. What size and shape of quadrat would you use to measure (a)…

A: Introduction-This protocol provides standardized data on seagrass percent cover, species…

Q: Which of the following regarding diuretics is false? Diuretics reduce the movement of water out of…

A: Our kidney play an important role in excretion.

Q: Argosomes Cytonemes

A: Cell biology is the study of cell structure and function, and it revolves around the concept that…

Q: What are additional benefits of switching to climate safe energy sources apart from reducing…

A: The gases that are responsible for the absorption and emission of radiant energy within the thermal…

Q: adaptive immune response

A: Immunity : The ability of the host to fight against the disease causing organism i.e., pathogen…

Q: Identify if the following statements are true or false. Quantitative PCR is also known as the…

A: A real-time polymerase chain reaction is a molecular genetics lab technology that involves the…

Q: Consider a situation where you have a parental cross with the mother and father phenotypes listed…

A: Introduction:- Inheritance is the process of genetic information being passed down from parent to…

Q: A melting profile in Figure 2 shows the increase in UV absorption versus temperature for two DNA…

A:

Q: Identify whether the following statements are True or False. Answer it all.   8. Fraternal twins are…

A: Statement: Fraternal twins are the results when 2 eggs are released and 2 different sperm fertilize…

Q: Adding glucose to the plasma mimics the process of - secretion O reabsorption dialysis O filtration

A: ANSWER;- Filtration Explain;- filtration is the process in which solid particles in a fluid or…

Q: This is about ecological sampling methods in estimating plant cover. Define the following: cover,…

A: Plant cover in ecology is used to measure the abundance of plant species in a relative area covered…

Q: What are the principle and basic concepts of SMEAR PREPARATION? (please explain it thoroughly in a…

A: Introduction A smear is a small amount of culture spread in a very thin film on the surface of the…

Q: Provide five advantages of Next Generation Sequencing? and explain each of these advantages.

A: Here I will discuss about the advantages of next generation sequencing.

Q: Describe the function of the following RNAs. (i) mRNA (ii) piRNA

A: Introduction :- Ribonucleic acid is a polymeric molecule that plays a variety of roles in biology,…

Q: 5) cranial nerve II, the optic nerve sends nerve impulses to the brain carrying information about…

A: It is critical to learn and know the anatomy and physiology of the human body. Many changes in the…

Q: Refer to the figure showing a pair of homologous chromosomes. What process is demonstrated in this…

A: Introduction Meiosis is a type of cell division that occurs in sexually reproducing organisms' germ…

Q: The urine of an infant gives a positive reaction with 2,4 dinitrophenylhydrazine. Mass spectrometry…

A: Mass spectrometry  It is a analytical tool use for measuring mass to charge ratio.

Q: What is corpus luteum. How does it function as an endocrine gland?.

A: Introduction :- During the ovulatory phase, when an ovarian follicle releases an egg, the opened…

Q: what is a creation myth? why is knowing the creation myths important

A: What is creation myth-  A creation myth is the narrative about how people came to inhabit and how…

Q: Who should have access to James Lanahan’s gene testing report? Please give reasoning.

A: Answer :the genticist can have  the gene testing report of james lanahans  if he is not in the…

Q: estrogen receptor (ER)-positive or -negative.

A: Cancer : The condition where the cells in a specific part of the body grow and reproduce…

Q: Crop Rotation - B. Pastoral Nomadism –

A: A. Crop Rotation- The practice of planting different crops sequentially on the same plot of land to…

Q: Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the…

A: X linked disease  Those diseases which are linked to X chromosome of an individual and pass through…

Q: Label feedback loop of body fluid homeostasis: kidney anatomy (stimulus, sensor, response, set…

A: The kidneys filter the blood on a regular basis to maintain the body's fluid and electrolyte…

Q: 10. Ꮽ 11, 5

A: Introduction The ovary is a female reproductive system organ that contains multiple eggs (Ovum).…

Q: (i) Draw and explain how SPO11 can generate double strand breaks. (ii) What would be the…

A:

Q: Of what value is the plant pathogen Agrobacterium?

A: A plant pathogen is an organism that infects plants. While certain plant infections can affect…

Q: Explain sarcopenic obesity and its effect on the elderly.

A: Obesity is described as a condition in which the body consumes too much fat. Obesity is caused by…

Q: 2. For an SLR disease trait, in a parental cross where the male is unaffected and female is…

A: The most frequent kind of lupus is systemic lupus erythematosus (SLE). SLE is an autoimmune illness…

Q: P+OcZ-Y+A+// P¬O+Z+Y+A+ i) The lac operon consists of three structural genes, lacZ, lacY and lacA.…

A: The lactose operon (also known as the lac operon) is a set of genes that are specific for the uptake…

Q: Stem height in Wisconsin Fast Plants is a polygenic trait controlled by 6 genes. In a cross between…

A: Let us assume the 6 genes that control the stem height in Wisconsin Fast plants to be A, B, C, D, E…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.