A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription? Group of answer choices CGTUUTCAG CGAUUACUG GCUAAUGAC GCTAATGAC

A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription? Group of answer choices CGTUUTCAG CGAUUACUG GCUAAUGAC GCTAATGAC

Name: A section of template DNA has the following sequence of nitrogenous ba
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription?Group of answer choicesCGTUUTCAGCGAUUACUGGCUAAUGACGCTAATGAC

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
given the following DNA template, write out the cDNA, mRNA, tRNA anticodons, and give the amino acid sequence. what are the three possible outcomes if there ws a base substitution mutation were to occur to the template? template TAC CGC TCC GCC GTC GAC AAT ACC ACT
in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized RNA strand? Write the sequence from 5’ to 3’. What is the sequence of the template DNA strand? Write the sequence from 5’ to 3’.
Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA sequence that would be produced? TUTUCGUGUCTU AUAUCGUGACUA ATATCGTGACTA CGCATGTCAGC None of the above
Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′
Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?
Which of the following statements about the transcription process is correct? a. A protein is made from the RNA base sequence b. A protein is made from the DNA base sequence c. RNA is made complimentary to DNA d. DNA is made complimentary to RNA
The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C